Incidental Mutation 'R2159:Olfr1264'
ID235027
Institutional Source Beutler Lab
Gene Symbol Olfr1264
Ensembl Gene ENSMUSG00000075069
Gene Nameolfactory receptor 1264
SynonymsGA_x6K02T2Q125-51454183-51453257, MOR236-1
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90018526-90025577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90021538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 176 (V176E)
Ref Sequence ENSEMBL: ENSMUSP00000149126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099758] [ENSMUST00000214382] [ENSMUST00000216616] [ENSMUST00000217065]
Predicted Effect probably damaging
Transcript: ENSMUST00000099758
AA Change: V176E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097347
Gene: ENSMUSG00000075069
AA Change: V176E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.8e-47 PFAM
Pfam:7tm_1 39 285 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214382
Predicted Effect probably damaging
Transcript: ENSMUST00000216616
AA Change: V176E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216764
Predicted Effect probably benign
Transcript: ENSMUST00000217065
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Olfr1264
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1635:Olfr1264 UTSW 2 90021970 missense possibly damaging 0.94
R1758:Olfr1264 UTSW 2 90021329 missense probably benign
R1930:Olfr1264 UTSW 2 90021161 missense probably benign
R3977:Olfr1264 UTSW 2 90021745 missense probably damaging 1.00
R4028:Olfr1264 UTSW 2 90021223 missense probably damaging 1.00
R4884:Olfr1264 UTSW 2 90021643 missense probably benign 0.19
R5194:Olfr1264 UTSW 2 90021526 missense probably damaging 1.00
R5225:Olfr1264 UTSW 2 90021184 missense probably benign 0.00
R5399:Olfr1264 UTSW 2 90021923 missense probably benign 0.19
R5436:Olfr1264 UTSW 2 90021665 missense probably benign 0.25
R5753:Olfr1264 UTSW 2 90021503 missense possibly damaging 0.87
R6225:Olfr1264 UTSW 2 90021229 unclassified probably null
R6391:Olfr1264 UTSW 2 90021631 missense probably benign 0.03
R6531:Olfr1264 UTSW 2 90021457 missense probably benign 0.03
R7293:Olfr1264 UTSW 2 90021527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAACCACAGTGAAGTGAGCC -3'
(R):5'- CACAGTGATGGCCTATGACC -3'

Sequencing Primer
(F):5'- AGGTAGACAGAGCTTTCCGTCTC -3'
(R):5'- CGCTATGTGGCCATCTGCAAAC -3'
Posted On2014-10-01