Incidental Mutation 'R2159:Lcmt2'
ID235030
Institutional Source Beutler Lab
Gene Symbol Lcmt2
Ensembl Gene ENSMUSG00000074890
Gene Nameleucine carboxyl methyltransferase 2
Synonyms
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121128307-121140653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121139285 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 439 (P439L)
Ref Sequence ENSEMBL: ENSMUSP00000106302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028702] [ENSMUST00000066155] [ENSMUST00000099486] [ENSMUST00000110662] [ENSMUST00000110665] [ENSMUST00000110674] [ENSMUST00000119031]
Predicted Effect probably benign
Transcript: ENSMUST00000028702
SMART Domains Protein: ENSMUSP00000028702
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 1 276 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066155
SMART Domains Protein: ENSMUSP00000067133
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 1.6e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099486
AA Change: P219L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097085
Gene: ENSMUSG00000074890
AA Change: P219L

DomainStartEndE-ValueType
PDB:3P71|T 4 94 6e-12 PDB
SCOP:d1k3ia3 137 401 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110662
SMART Domains Protein: ENSMUSP00000106290
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 200 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110665
SMART Domains Protein: ENSMUSP00000106293
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 2 236 4.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110674
AA Change: P439L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106302
Gene: ENSMUSG00000074890
AA Change: P439L

DomainStartEndE-ValueType
Pfam:LCM 12 207 5.4e-28 PFAM
Pfam:Kelch_3 492 542 2.2e-6 PFAM
low complexity region 544 563 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119031
SMART Domains Protein: ENSMUSP00000113052
Gene: ENSMUSG00000027259

DomainStartEndE-ValueType
Pfam:A_deaminase 16 343 3e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene belongs to the highly variable methyltransferase superfamily. This gene is the inferred homolog of the Saccharomyces cerevisiae carboxymethyltransferase gene PPM2 that is essential for the synthesis of the hypermodified guanosine Wybutosine (yW). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Lcmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Lcmt2 APN 2 121138913 missense possibly damaging 0.94
R0352:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R0519:Lcmt2 UTSW 2 121139344 unclassified probably null
R0685:Lcmt2 UTSW 2 121139240 missense probably benign 0.14
R1437:Lcmt2 UTSW 2 121138896 missense probably benign 0.06
R1500:Lcmt2 UTSW 2 121140007 missense probably benign 0.00
R1569:Lcmt2 UTSW 2 121139828 missense probably damaging 1.00
R1612:Lcmt2 UTSW 2 121139120 missense probably damaging 1.00
R1618:Lcmt2 UTSW 2 121138652 missense probably damaging 0.98
R1990:Lcmt2 UTSW 2 121140281 missense probably benign 0.07
R2091:Lcmt2 UTSW 2 121138616 missense probably damaging 1.00
R3812:Lcmt2 UTSW 2 121138706 missense probably benign 0.01
R4725:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4727:Lcmt2 UTSW 2 121139430 missense probably benign 0.00
R4968:Lcmt2 UTSW 2 121139736 missense probably benign 0.00
R5626:Lcmt2 UTSW 2 121139462 missense probably benign
R6246:Lcmt2 UTSW 2 121140389 missense probably damaging 1.00
R6326:Lcmt2 UTSW 2 121139457 nonsense probably null
R6524:Lcmt2 UTSW 2 121138931 missense possibly damaging 0.75
R6924:Lcmt2 UTSW 2 121140003 missense probably benign
R7282:Lcmt2 UTSW 2 121138790 missense probably damaging 1.00
R7405:Lcmt2 UTSW 2 121139387 missense probably benign 0.07
R7408:Lcmt2 UTSW 2 121138704 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTACAGGTTCAGCCACACTTC -3'
(R):5'- TGCAGGAGGCTTTGGAGAAC -3'

Sequencing Primer
(F):5'- TCAGCCACACTTCGGCCAC -3'
(R):5'- CAAGAGGGACGACACTGCC -3'
Posted On2014-10-01