Incidental Mutation 'R2159:Vmn2r8'
ID235037
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Namevomeronasal 2, receptor 8
SynonymsEG627479
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108797193-108808754 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108802303 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 226 (E226V)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
Predicted Effect probably benign
Transcript: ENSMUST00000172140
AA Change: E226V

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: E226V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108802225 missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108797941 unclassified probably null
R0335:Vmn2r8 UTSW 5 108797451 unclassified probably null
R0394:Vmn2r8 UTSW 5 108802072 missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108803183 missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108799329 missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108800546 missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108803176 missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108803219 nonsense probably null
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1406:Vmn2r8 UTSW 5 108802368 missense probably benign
R1451:Vmn2r8 UTSW 5 108798067 missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108802174 missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108803106 missense probably benign
R1874:Vmn2r8 UTSW 5 108802418 missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108797570 missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108802153 missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108799286 missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108798095 missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108802383 missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108808621 missense possibly damaging 0.94
R4240:Vmn2r8 UTSW 5 108797503 missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108801704 missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108808581 missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108801700 missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108797398 missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108799263 missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108808706 missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108801770 missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108802240 missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108802459 missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108797382 missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108799345 missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108808597 missense probably benign
R6315:Vmn2r8 UTSW 5 108801891 missense probably benign
R6413:Vmn2r8 UTSW 5 108801723 missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108808638 missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108800576 missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108808583 nonsense probably null
R7489:Vmn2r8 UTSW 5 108797656 missense possibly damaging 0.95
R7532:Vmn2r8 UTSW 5 108802240 missense probably benign 0.22
R7534:Vmn2r8 UTSW 5 108802174 missense possibly damaging 0.94
Z1088:Vmn2r8 UTSW 5 108801998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCATTGTGATGTTGTGATCC -3'
(R):5'- CATTTAATCCTGACCTGAGGGACC -3'

Sequencing Primer
(F):5'- TGATGTTGTGATCCAGATTCTCC -3'
(R):5'- TGAGGGACCATGACCAGTTTC -3'
Posted On2014-10-01