Incidental Mutation 'R2159:Sftpb'
ID235042
Institutional Source Beutler Lab
Gene Symbol Sftpb
Ensembl Gene ENSMUSG00000056370
Gene Namesurfactant associated protein B
SynonymsSftp-3, SP-B, SF-B, Sftp3
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location72304610-72314371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72309786 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 226 (C226R)
Ref Sequence ENSEMBL: ENSMUSP00000138485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070437] [ENSMUST00000182014] [ENSMUST00000183018] [ENSMUST00000183278]
Predicted Effect probably damaging
Transcript: ENSMUST00000070437
AA Change: C226R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066805
Gene: ENSMUSG00000056370
AA Change: C226R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
SapB 197 267 7.13e-10 SMART
SapB 292 361 2.5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182014
AA Change: C226R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138204
Gene: ENSMUSG00000056370
AA Change: C226R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182765
SMART Domains Protein: ENSMUSP00000138298
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
Blast:SapB 43 91 1e-20 BLAST
PDB:2JOU|A 45 92 1e-7 PDB
SapB 116 185 2.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183018
SMART Domains Protein: ENSMUSP00000138695
Gene: ENSMUSG00000056370

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
Blast:SapB 197 245 3e-19 BLAST
PDB:2JOU|A 199 246 3e-7 PDB
SapB 270 339 2.5e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183278
AA Change: C226R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138485
Gene: ENSMUSG00000056370
AA Change: C226R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SAPA 27 60 1.27e-16 SMART
SapB 66 142 4.21e-21 SMART
low complexity region 159 182 N/A INTRINSIC
PDB:1DFW|A 192 216 1e-7 PDB
Blast:SapB 197 234 3e-15 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pulmonary-associated surfactant protein B (SPB), an amphipathic surfactant protein essential for lung function and homeostasis after birth. Pulmonary surfactant is a surface-active lipoprotein complex composed of 90% lipids and 10% proteins which include plasma proteins and apolipoproteins SPA, SPB, SPC and SPD. The surfactant is secreted by the alveolar cells of the lung and maintains the stability of pulmonary tissue by reducing the surface tension of fluids that coat the lung. The SPB enhances the rate of spreading and increases the stability of surfactant monolayers in vitro. Multiple mutations in this gene have been identified, which cause pulmonary surfactant metabolism dysfunction type 1, also called pulmonary alveolar proteinosis due to surfactant protein B deficiency, and are associated with fatal respiratory distress in the neonatal period. Alternatively spliced transcript variants encoding the same protein have been identified.[provided by RefSeq, Feb 2010]
PHENOTYPE: Inactivation of this gene results in respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Sftpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Sftpb APN 6 72309862 missense probably benign 0.03
IGL02013:Sftpb APN 6 72305671 missense probably benign 0.08
R1741:Sftpb UTSW 6 72305813 missense probably benign 0.03
R5108:Sftpb UTSW 6 72304656 missense probably damaging 1.00
R5315:Sftpb UTSW 6 72306892 missense probably benign 0.31
R5506:Sftpb UTSW 6 72304667 missense possibly damaging 0.46
R6415:Sftpb UTSW 6 72304649 missense probably damaging 0.96
R6622:Sftpb UTSW 6 72305655 missense possibly damaging 0.95
R7130:Sftpb UTSW 6 72305824 missense possibly damaging 0.89
R7342:Sftpb UTSW 6 72309875 missense probably benign 0.01
R7527:Sftpb UTSW 6 72305064 missense possibly damaging 0.69
R7644:Sftpb UTSW 6 72309835 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CTTGGATGCTCAGTGACCTG -3'
(R):5'- TGAACCCCACCTTGTCCATG -3'

Sequencing Primer
(F):5'- GTGGACAGAACTGCTCTTTCCTAG -3'
(R):5'- CCATGTGCACTGGAGGGATG -3'
Posted On2014-10-01