Mutagenetix > Incidental Mutation

Incidental Mutation 'R2159:Vwf'

235044

Institutional Source

Beutler Lab

Gene Symbol

Vwf

Ensembl Gene

ENSMUSG00000001930

Gene Name

Von Willebrand factor

Synonyms

B130011O06Rik, 6820430P06Rik

MMRRC Submission

040162-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R2159 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125529911-125663642 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125603304 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 885 (F885L)

Ref Sequence

ENSEMBL: ENSMUSP00000107873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112254]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000112254
AA Change: F885L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: F885L

Domain	Start	End	E-Value	Type
VWD	23	181	3.43e-35	SMART
C8	221	295	1.11e-21	SMART
Pfam:TIL	298	351	6.9e-15	PFAM
VWC	353	413	8.71e-1	SMART
VWD	380	543	2.93e-52	SMART
C8	580	652	3.82e-25	SMART
Pfam:TIL	655	710	4.1e-14	PFAM
EGF_like	790	825	4.37e1	SMART
VWC	832	901	3.29e-3	SMART
VWD	859	1015	5.15e-39	SMART
C8	1056	1130	1.01e-33	SMART
Pfam:TIL	1144	1199	1.3e-9	PFAM
VWA	1278	1461	1.81e-20	SMART
low complexity region	1464	1477	N/A	INTRINSIC
VWA	1499	1672	8.43e-39	SMART
VWA	1692	1875	2.83e-31	SMART
VWC	1882	1949	2.99e0	SMART
VWD	1941	2104	5.03e-42	SMART
C8	2135	2203	1.29e-13	SMART
Pfam:TIL	2206	2257	8.3e-8	PFAM
VWC	2260	2328	3.16e-16	SMART
low complexity region	2417	2428	N/A	INTRINSIC
VWC	2434	2497	2.61e-17	SMART
VWC	2513	2577	3.37e0	SMART
VWC	2585	2647	2.55e-11	SMART
CT	2730	2815	1.37e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134073

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]

Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam21	G	A	12: 81,607,241 (GRCm39)	P174S	probably benign	Het
Aida	C	T	1: 183,103,234 (GRCm39)	P185S	probably benign	Het
Alg11	T	G	8: 22,555,861 (GRCm39)	I374R	probably benign	Het
Ano9	T	C	7: 140,688,030 (GRCm39)	I229V	probably benign	Het
Apob	A	T	12: 8,060,081 (GRCm39)	L2821F	probably benign	Het
Atp10b	C	T	11: 43,042,680 (GRCm39)	T80I	possibly damaging	Het
BC024139	T	C	15: 76,005,688 (GRCm39)	H478R	probably damaging	Het
Btbd1	A	T	7: 81,450,804 (GRCm39)	D325E	possibly damaging	Het
Camk2a	G	A	18: 61,090,257 (GRCm39)	C199Y	probably damaging	Het
Casp3	A	G	8: 47,087,323 (GRCm39)	D90G	probably damaging	Het
Ccnt2	A	G	1: 127,702,891 (GRCm39)	H71R	probably benign	Het
Cdk2ap1	G	A	5: 124,486,667 (GRCm39)	R65*	probably null	Het
Cebpb	G	T	2: 167,531,173 (GRCm39)	A78S	probably benign	Het
Col5a3	A	G	9: 20,682,606 (GRCm39)	F1613L	unknown	Het
Cpd	T	C	11: 76,688,467 (GRCm39)	D935G	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,604,632 (GRCm39)		probably null	Het
Cwc27	A	G	13: 104,940,837 (GRCm39)	I174T	probably damaging	Het
Cyp21a1	C	A	17: 35,021,378 (GRCm39)	R331L	probably benign	Het
Dnah5	A	G	15: 28,252,691 (GRCm39)	T795A	probably benign	Het
Eif2ak2	A	G	17: 79,181,447 (GRCm39)	V100A	possibly damaging	Het
Foxa3	A	G	7: 18,748,109 (GRCm39)	V339A	probably benign	Het
Gp2	T	C	7: 119,051,507 (GRCm39)	D236G	probably benign	Het
Gprc6a	CAAA	CA	10: 51,491,776 (GRCm39)		probably null	Het
Gzmd	T	A	14: 56,368,153 (GRCm39)	H102L	probably damaging	Het
Klk1b1	A	T	7: 43,619,857 (GRCm39)	I139F	probably damaging	Het
Lcmt2	G	A	2: 120,969,766 (GRCm39)	P439L	probably damaging	Het
Loxl4	C	T	19: 42,588,446 (GRCm39)	A570T	probably damaging	Het
Mga	T	A	2: 119,750,124 (GRCm39)	H674Q	probably damaging	Het
Mybpc3	A	T	2: 90,955,715 (GRCm39)	K583M	probably damaging	Het
Ncoa6	G	T	2: 155,249,633 (GRCm39)	P1224T	probably damaging	Het
Nostrin	A	G	2: 69,011,266 (GRCm39)		probably null	Het
Or13e8	T	C	4: 43,697,110 (GRCm39)	H21R	probably benign	Het
Or4c3	A	T	2: 89,851,882 (GRCm39)	V176E	probably damaging	Het
Oxsr1	A	C	9: 119,133,880 (GRCm39)	D58E	possibly damaging	Het
Parm1	A	G	5: 91,760,923 (GRCm39)	Y265C	probably damaging	Het
Phf10	C	T	17: 15,172,926 (GRCm39)	E304K	probably damaging	Het
Prmt5	T	C	14: 54,752,795 (GRCm39)	T139A	probably benign	Het
Ptgir	A	G	7: 16,640,794 (GRCm39)	M29V	possibly damaging	Het
Ptp4a3	A	G	15: 73,623,865 (GRCm39)	T32A	probably benign	Het
Pwwp2b	A	T	7: 138,834,844 (GRCm39)	D95V	possibly damaging	Het
Rad51ap2	T	C	12: 11,507,752 (GRCm39)	L558S	possibly damaging	Het
Rapgef4	A	G	2: 72,005,225 (GRCm39)	D80G	probably damaging	Het
Sec24a	T	G	11: 51,603,177 (GRCm39)	H757P	probably damaging	Het
Sema4d	T	C	13: 51,874,571 (GRCm39)	N129D	probably damaging	Het
Serpini1	A	G	3: 75,531,251 (GRCm39)	T323A	probably benign	Het
Setd1a	G	A	7: 127,384,661 (GRCm39)	R504H	possibly damaging	Het
Sftpb	T	C	6: 72,286,770 (GRCm39)	C226R	probably damaging	Het
Sp8	T	C	12: 118,812,441 (GRCm39)	S99P	possibly damaging	Het
Srgap3	A	G	6: 112,748,339 (GRCm39)	F438L	probably damaging	Het
Stim2	T	C	5: 54,267,156 (GRCm39)	Y365H	probably damaging	Het
Stk36	A	G	1: 74,673,896 (GRCm39)	Q1263R	probably benign	Het
Tectb	C	G	19: 55,169,431 (GRCm39)		probably benign	Het
Troap	G	T	15: 98,975,467 (GRCm39)	A184S	probably damaging	Het
Ttn	G	A	2: 76,729,671 (GRCm39)		probably benign	Het
Vmn2r108	C	A	17: 20,689,363 (GRCm39)	A531S	probably benign	Het
Vmn2r12	T	A	5: 109,239,340 (GRCm39)	I408F	probably benign	Het
Vmn2r8	T	A	5: 108,950,169 (GRCm39)	E226V	probably benign	Het
Vmo1	A	G	11: 70,404,608 (GRCm39)	F131S	probably benign	Het
Wdpcp	A	T	11: 21,807,476 (GRCm39)	M618L	probably benign	Het
Wdr90	T	C	17: 26,070,715 (GRCm39)	E1072G	probably benign	Het

Other mutations in Vwf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Vwf	APN	6	125,635,835 (GRCm39)	missense	unknown
IGL00561:Vwf	APN	6	125,619,684 (GRCm39)	missense	possibly damaging	0.88
IGL01104:Vwf	APN	6	125,660,519 (GRCm39)	missense	probably damaging	1.00
IGL01404:Vwf	APN	6	125,654,933 (GRCm39)	missense	probably damaging	1.00
IGL01539:Vwf	APN	6	125,567,225 (GRCm39)	missense	possibly damaging	0.85
IGL01550:Vwf	APN	6	125,656,252 (GRCm39)	missense	probably benign	0.00
IGL01563:Vwf	APN	6	125,568,128 (GRCm39)	missense	probably damaging	1.00
IGL01637:Vwf	APN	6	125,622,699 (GRCm39)	missense	probably damaging	1.00
IGL01720:Vwf	APN	6	125,619,798 (GRCm39)	missense	possibly damaging	0.69
IGL01834:Vwf	APN	6	125,567,133 (GRCm39)	splice site	probably benign
IGL02103:Vwf	APN	6	125,623,318 (GRCm39)	missense	probably damaging	1.00
IGL02120:Vwf	APN	6	125,592,997 (GRCm39)	missense	probably benign	0.26
IGL02174:Vwf	APN	6	125,532,358 (GRCm39)	missense	probably damaging	1.00
IGL02203:Vwf	APN	6	125,619,369 (GRCm39)	missense	probably damaging	1.00
IGL02420:Vwf	APN	6	125,654,879 (GRCm39)	missense	probably benign	0.00
IGL02723:Vwf	APN	6	125,619,893 (GRCm39)	missense	possibly damaging	0.85
IGL02818:Vwf	APN	6	125,640,511 (GRCm39)	missense	probably benign
IGL02931:Vwf	APN	6	125,592,931 (GRCm39)	missense	possibly damaging	0.68
IGL03015:Vwf	APN	6	125,661,101 (GRCm39)	splice site	probably benign
IGL03038:Vwf	APN	6	125,581,120 (GRCm39)	missense	possibly damaging	0.92
IGL03060:Vwf	APN	6	125,640,523 (GRCm39)	missense	probably damaging	1.00
IGL03114:Vwf	APN	6	125,576,326 (GRCm39)	nonsense	probably null
IGL03266:Vwf	APN	6	125,655,040 (GRCm39)	splice site	probably benign
gingerman	UTSW	6	125,639,926 (GRCm39)	critical splice acceptor site	probably null
R0605_vwf_644	UTSW	6	125,662,800 (GRCm39)	missense	probably benign	0.02
R1575_Vwf_091	UTSW	6	125,640,534 (GRCm39)	nonsense	probably null
R1628_Vwf_608	UTSW	6	125,624,701 (GRCm39)	unclassified	probably benign
R1669_Vwf_448	UTSW	6	125,624,869 (GRCm39)	missense	possibly damaging	0.92
R1833_Vwf_948	UTSW	6	125,619,000 (GRCm39)	missense	probably benign	0.14
R2130_vwf_946	UTSW	6	125,634,020 (GRCm39)	missense	probably damaging	1.00
R6360_Vwf_065	UTSW	6	125,660,489 (GRCm39)	missense	probably benign	0.13
R7900_Vwf_938	UTSW	6	125,605,439 (GRCm39)	critical splice donor site	probably null
Russiahouse	UTSW	6	125,616,304 (GRCm39)	nonsense	probably null
B5639:Vwf	UTSW	6	125,619,947 (GRCm39)	missense	probably damaging	1.00
R0025:Vwf	UTSW	6	125,659,775 (GRCm39)	missense	probably benign	0.05
R0025:Vwf	UTSW	6	125,659,775 (GRCm39)	missense	probably benign	0.05
R0087:Vwf	UTSW	6	125,622,917 (GRCm39)	missense	probably benign	0.03
R0194:Vwf	UTSW	6	125,620,260 (GRCm39)	missense	probably benign
R0206:Vwf	UTSW	6	125,614,419 (GRCm39)	missense	probably damaging	1.00
R0233:Vwf	UTSW	6	125,663,473 (GRCm39)	missense	possibly damaging	0.91
R0233:Vwf	UTSW	6	125,663,473 (GRCm39)	missense	possibly damaging	0.91
R0390:Vwf	UTSW	6	125,603,324 (GRCm39)	nonsense	probably null
R0427:Vwf	UTSW	6	125,650,902 (GRCm39)	missense	probably benign
R0437:Vwf	UTSW	6	125,543,281 (GRCm39)	missense	probably damaging	1.00
R0470:Vwf	UTSW	6	125,605,391 (GRCm39)	missense	possibly damaging	0.70
R0499:Vwf	UTSW	6	125,615,077 (GRCm39)	missense	probably benign	0.10
R0554:Vwf	UTSW	6	125,619,744 (GRCm39)	missense	probably benign	0.13
R0605:Vwf	UTSW	6	125,662,800 (GRCm39)	missense	probably benign	0.02
R0711:Vwf	UTSW	6	125,603,234 (GRCm39)	missense	probably benign	0.01
R0723:Vwf	UTSW	6	125,543,225 (GRCm39)	missense	probably benign	0.01
R0973:Vwf	UTSW	6	125,619,969 (GRCm39)	missense	probably damaging	1.00
R1054:Vwf	UTSW	6	125,567,190 (GRCm39)	missense	probably damaging	1.00
R1115:Vwf	UTSW	6	125,632,028 (GRCm39)	missense	unknown
R1156:Vwf	UTSW	6	125,614,451 (GRCm39)	missense	probably damaging	1.00
R1191:Vwf	UTSW	6	125,576,215 (GRCm39)	missense	probably damaging	1.00
R1240:Vwf	UTSW	6	125,580,271 (GRCm39)	splice site	probably null
R1398:Vwf	UTSW	6	125,580,420 (GRCm39)	missense	probably benign	0.02
R1435:Vwf	UTSW	6	125,619,212 (GRCm39)	nonsense	probably null
R1528:Vwf	UTSW	6	125,585,254 (GRCm39)	missense	possibly damaging	0.69
R1575:Vwf	UTSW	6	125,640,534 (GRCm39)	nonsense	probably null
R1575:Vwf	UTSW	6	125,632,214 (GRCm39)	missense	unknown
R1628:Vwf	UTSW	6	125,624,701 (GRCm39)	unclassified	probably benign
R1669:Vwf	UTSW	6	125,624,869 (GRCm39)	missense	possibly damaging	0.92
R1699:Vwf	UTSW	6	125,662,863 (GRCm39)	missense	possibly damaging	0.74
R1699:Vwf	UTSW	6	125,620,032 (GRCm39)	missense	probably damaging	1.00
R1725:Vwf	UTSW	6	125,623,245 (GRCm39)	missense	probably benign	0.05
R1742:Vwf	UTSW	6	125,644,513 (GRCm39)	missense	probably benign	0.02
R1809:Vwf	UTSW	6	125,567,138 (GRCm39)	splice site	probably benign
R1833:Vwf	UTSW	6	125,619,000 (GRCm39)	missense	probably benign	0.14
R1866:Vwf	UTSW	6	125,644,492 (GRCm39)	missense	possibly damaging	0.62
R1870:Vwf	UTSW	6	125,619,902 (GRCm39)	missense	probably damaging	1.00
R1874:Vwf	UTSW	6	125,605,335 (GRCm39)	missense	probably benign	0.00
R1941:Vwf	UTSW	6	125,616,242 (GRCm39)	missense	possibly damaging	0.64
R2061:Vwf	UTSW	6	125,568,151 (GRCm39)	missense	probably damaging	0.98
R2103:Vwf	UTSW	6	125,623,293 (GRCm39)	missense	probably benign	0.31
R2104:Vwf	UTSW	6	125,623,293 (GRCm39)	missense	probably benign	0.31
R2130:Vwf	UTSW	6	125,634,020 (GRCm39)	missense	probably damaging	1.00
R2178:Vwf	UTSW	6	125,619,095 (GRCm39)	missense	possibly damaging	0.90
R2656:Vwf	UTSW	6	125,532,324 (GRCm39)	missense	probably benign	0.00
R2913:Vwf	UTSW	6	125,662,809 (GRCm39)	missense	probably benign	0.08
R2917:Vwf	UTSW	6	125,585,106 (GRCm39)	missense	probably benign	0.07
R3726:Vwf	UTSW	6	125,654,911 (GRCm39)	utr 3 prime	probably benign
R3735:Vwf	UTSW	6	125,565,576 (GRCm39)	missense	probably damaging	1.00
R3774:Vwf	UTSW	6	125,626,062 (GRCm39)	splice site	probably null
R3934:Vwf	UTSW	6	125,532,462 (GRCm39)	missense	probably damaging	1.00
R4291:Vwf	UTSW	6	125,619,285 (GRCm39)	missense	probably damaging	1.00
R4384:Vwf	UTSW	6	125,632,079 (GRCm39)	missense	unknown
R4743:Vwf	UTSW	6	125,661,054 (GRCm39)	critical splice acceptor site	probably null
R4760:Vwf	UTSW	6	125,547,567 (GRCm39)	missense	probably damaging	1.00
R4776:Vwf	UTSW	6	125,543,268 (GRCm39)	missense	possibly damaging	0.53
R4791:Vwf	UTSW	6	125,620,326 (GRCm39)	missense
R4871:Vwf	UTSW	6	125,663,425 (GRCm39)	missense	probably benign	0.25
R4894:Vwf	UTSW	6	125,622,897 (GRCm39)	nonsense	probably null
R4963:Vwf	UTSW	6	125,644,446 (GRCm39)	nonsense	probably null
R5010:Vwf	UTSW	6	125,543,220 (GRCm39)	missense	probably benign	0.15
R5289:Vwf	UTSW	6	125,644,473 (GRCm39)	utr 3 prime	probably benign
R5512:Vwf	UTSW	6	125,650,850 (GRCm39)	utr 3 prime	probably benign
R5523:Vwf	UTSW	6	125,620,005 (GRCm39)	missense
R5642:Vwf	UTSW	6	125,580,381 (GRCm39)	missense
R5860:Vwf	UTSW	6	125,656,228 (GRCm39)	utr 3 prime	probably benign
R5860:Vwf	UTSW	6	125,620,053 (GRCm39)	missense
R5896:Vwf	UTSW	6	125,655,725 (GRCm39)	critical splice acceptor site	probably null
R5926:Vwf	UTSW	6	125,581,137 (GRCm39)	missense	probably damaging	1.00
R5976:Vwf	UTSW	6	125,580,426 (GRCm39)	missense
R6053:Vwf	UTSW	6	125,577,628 (GRCm39)	missense	probably benign	0.21
R6151:Vwf	UTSW	6	125,634,028 (GRCm39)	missense	unknown
R6179:Vwf	UTSW	6	125,626,252 (GRCm39)	missense	unknown
R6181:Vwf	UTSW	6	125,543,109 (GRCm39)	missense	probably damaging	0.98
R6234:Vwf	UTSW	6	125,634,128 (GRCm39)	missense	unknown
R6360:Vwf	UTSW	6	125,660,489 (GRCm39)	missense	probably benign	0.13
R6412:Vwf	UTSW	6	125,656,279 (GRCm39)	missense	probably benign	0.00
R6464:Vwf	UTSW	6	125,616,363 (GRCm39)	critical splice donor site	probably null
R6522:Vwf	UTSW	6	125,639,926 (GRCm39)	critical splice acceptor site	probably null
R6766:Vwf	UTSW	6	125,616,339 (GRCm39)	missense	unknown
R6856:Vwf	UTSW	6	125,619,113 (GRCm39)	nonsense	probably null
R6877:Vwf	UTSW	6	125,634,164 (GRCm39)	missense	possibly damaging	0.48
R6896:Vwf	UTSW	6	125,543,157 (GRCm39)	missense	probably damaging	1.00
R7113:Vwf	UTSW	6	125,632,007 (GRCm39)	missense
R7287:Vwf	UTSW	6	125,614,430 (GRCm39)	missense
R7359:Vwf	UTSW	6	125,543,220 (GRCm39)	missense
R7509:Vwf	UTSW	6	125,619,132 (GRCm39)	missense
R7519:Vwf	UTSW	6	125,644,506 (GRCm39)	missense
R7545:Vwf	UTSW	6	125,591,060 (GRCm39)	missense
R7549:Vwf	UTSW	6	125,603,230 (GRCm39)	missense
R7593:Vwf	UTSW	6	125,624,731 (GRCm39)	missense
R7635:Vwf	UTSW	6	125,659,697 (GRCm39)	missense
R7793:Vwf	UTSW	6	125,663,483 (GRCm39)	missense
R7802:Vwf	UTSW	6	125,643,640 (GRCm39)	missense
R7824:Vwf	UTSW	6	125,635,778 (GRCm39)	missense
R7849:Vwf	UTSW	6	125,633,766 (GRCm39)	missense
R7900:Vwf	UTSW	6	125,605,439 (GRCm39)	critical splice donor site	probably null
R7919:Vwf	UTSW	6	125,624,822 (GRCm39)	missense
R7966:Vwf	UTSW	6	125,616,304 (GRCm39)	nonsense	probably null
R8101:Vwf	UTSW	6	125,547,522 (GRCm39)	nonsense	probably null
R8162:Vwf	UTSW	6	125,622,799 (GRCm39)	splice site	probably null
R8345:Vwf	UTSW	6	125,656,265 (GRCm39)	missense
R8853:Vwf	UTSW	6	125,634,227 (GRCm39)	missense
R9027:Vwf	UTSW	6	125,643,626 (GRCm39)	missense
R9065:Vwf	UTSW	6	125,623,262 (GRCm39)	missense
R9068:Vwf	UTSW	6	125,625,792 (GRCm39)	unclassified	probably benign
R9128:Vwf	UTSW	6	125,619,693 (GRCm39)	missense
R9136:Vwf	UTSW	6	125,576,356 (GRCm39)	splice site	probably benign
R9164:Vwf	UTSW	6	125,542,806 (GRCm39)	missense
R9177:Vwf	UTSW	6	125,581,254 (GRCm39)	missense
R9334:Vwf	UTSW	6	125,654,909 (GRCm39)	missense
R9508:Vwf	UTSW	6	125,532,471 (GRCm39)	missense
R9553:Vwf	UTSW	6	125,577,662 (GRCm39)	missense
R9660:Vwf	UTSW	6	125,568,670 (GRCm39)	missense	possibly damaging	0.61
R9706:Vwf	UTSW	6	125,601,536 (GRCm39)	missense
R9708:Vwf	UTSW	6	125,634,053 (GRCm39)	missense
R9712:Vwf	UTSW	6	125,601,536 (GRCm39)	missense
R9714:Vwf	UTSW	6	125,601,536 (GRCm39)	missense
R9728:Vwf	UTSW	6	125,568,670 (GRCm39)	missense	possibly damaging	0.61
R9758:Vwf	UTSW	6	125,603,230 (GRCm39)	missense
X0021:Vwf	UTSW	6	125,623,294 (GRCm39)	missense	probably damaging	1.00
X0065:Vwf	UTSW	6	125,580,396 (GRCm39)	missense	probably null	0.05
Z1176:Vwf	UTSW	6	125,580,271 (GRCm39)	splice site	probably null
Z1176:Vwf	UTSW	6	125,568,194 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TTTCCTAAGGCCTGATTGAACC -3'
(R):5'- TACCAGTCCAGCTCAGAAAATG -3'

Sequencing Primer
(F):5'- TGATTGAACCCCTGGTGCCTAAG -3'
(R):5'- AAACTTCCTACATCGTTGGGC -3'

Posted On

2014-10-01