Incidental Mutation 'R2159:Klk1b1'
ID235047
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Namekallikrein 1-related peptidase b1
SynonymsmGK-1, tissue kallikrein, TK, Klk1, mK1
MMRRC Submission 040162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2159 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43966751-43971318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43970433 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 139 (I139F)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
Predicted Effect probably damaging
Transcript: ENSMUST00000078835
AA Change: I139F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: I139F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206796
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43971169 missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43970365 missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43970476 missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43970741 nonsense probably null
R0689:Klk1b1 UTSW 7 43970719 missense probably benign
R1552:Klk1b1 UTSW 7 43969343 missense probably damaging 1.00
R1697:Klk1b1 UTSW 7 43970326 missense probably benign 0.01
R1737:Klk1b1 UTSW 7 43970359 missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43970623 missense possibly damaging 0.73
R2177:Klk1b1 UTSW 7 43969271 missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43970481 missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R2510:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43969327 missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43971169 missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43970657 missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43969247 missense probably damaging 0.99
R7535:Klk1b1 UTSW 7 43970322 missense probably damaging 1.00
R7752:Klk1b1 UTSW 7 43971245 missense probably damaging 1.00
R7901:Klk1b1 UTSW 7 43971245 missense probably damaging 1.00
R8320:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8379:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8381:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8383:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8511:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
X0012:Klk1b1 UTSW 7 43970659 missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43970401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGATGAACCCTCTGCTC -3'
(R):5'- CCTCATTAGGCAGGAGCTTG -3'

Sequencing Primer
(F):5'- TGCTCAGCACCGATTAGTCAG -3'
(R):5'- AGCTTGAGGTTCACACACTG -3'
Posted On2014-10-01