Mutagenetix > Incidental Mutation

Incidental Mutation 'R0197:Ap3d1'

23505

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

038456-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R0197 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80730042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 97 (A97E)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

AlphaFold

O54774

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: A97E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: A97E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000219356
AA Change: A90E

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 92.5%
20x: 75.9%

Validation Efficiency

97% (121/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
2610507B11Rik	A	C	11: 78,269,704		probably benign	Het
4930452B06Rik	C	T	14: 8,518,695	G254R	probably damaging	Het
Abcc2	A	T	19: 43,826,614	R1147*	probably null	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Aldh9a1	A	G	1: 167,361,847	D388G	probably damaging	Het
Arhgef10	T	A	8: 14,962,636	V320E	probably damaging	Het
Baiap2l1	C	A	5: 144,266,010	V498L	probably damaging	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Col4a3bp	T	A	13: 96,549,287	Y63N	probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Dlx5	T	C	6: 6,881,619	K90E	possibly damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Espnl	T	G	1: 91,344,489	Y524D	probably damaging	Het
Fam20c	T	C	5: 138,755,724	L30P	probably damaging	Het
Fat1	G	T	8: 45,026,553	A2879S	probably benign	Het
Gabrg1	A	T	5: 70,774,389	V337D	probably damaging	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gcc1	T	C	6: 28,420,616	H234R	probably damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Glt6d1	A	G	2: 25,794,070	I308T	probably benign	Het
Gm10320	T	C	13: 98,491,983	T7A	probably benign	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm13088	C	T	4: 143,656,440	E70K	possibly damaging	Het
Gmpr2	T	A	14: 55,672,735	D7E	possibly damaging	Het
Hc	A	G	2: 34,984,750	Y1620H	probably damaging	Het
Hoxa3	T	C	6: 52,170,143		probably benign	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Kdr	G	T	5: 75,968,422	T188N	possibly damaging	Het
Lepr	A	T	4: 101,752,152	D312V	possibly damaging	Het
Mcm3	A	G	1: 20,810,105	V501A	probably damaging	Het
Mcur1	T	C	13: 43,545,740	Y267C	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mroh2a	G	C	1: 88,246,042	A871P	probably damaging	Het
Ndrg2	T	A	14: 51,907,003		probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Onecut2	T	A	18: 64,341,472	S365T	possibly damaging	Het
Pds5b	C	A	5: 150,754,431	Q505K	probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Samd3	T	A	10: 26,271,854	C476S	possibly damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Smpd4	T	A	16: 17,641,597		probably null	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Svep1	T	C	4: 58,070,851	K2312E	possibly damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Usp24	T	A	4: 106,407,133	W1754R	probably damaging	Het
Utp20	G	A	10: 88,777,516	P1301L	probably benign	Het
Vmn2r115	T	A	17: 23,359,781	S743T	probably damaging	Het
Vps41	T	G	13: 18,854,663		probably null	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
Particle	UTSW	10	80710494	splice site	probably null
vesicle	UTSW	10	80723827	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80730882	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80716591	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80712118	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80709793	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80719084	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80723827	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80709821	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80709228	missense	probably benign
R9664:Ap3d1	UTSW	10	80712805	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80709775	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- ATGTGAAGGCCCATGCTTGCTG -3'
(R):5'- TATGAGAACTAGGGTGCTGCCTCC -3'

Sequencing Primer
(F):5'- GATCTCTCATCTGCTGAGACACAG -3'
(R):5'- GCAATGAAGCTAGAACCATCTG -3'

Posted On

2013-04-16