Incidental Mutation 'R2159:Gprc6a'
ID235058
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040162-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2159 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAA to CA at 51615680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably null
Transcript: ENSMUST00000020062
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
Predicted Effect probably null
Transcript: ENSMUST00000219286
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 G A 12: 81,560,467 P174S probably benign Het
Aida C T 1: 183,322,379 P185S probably benign Het
Alg11 T G 8: 22,065,845 I374R probably benign Het
Ano9 T C 7: 141,108,117 I229V probably benign Het
Apob A T 12: 8,010,081 L2821F probably benign Het
Atp10b C T 11: 43,151,853 T80I possibly damaging Het
BC024139 T C 15: 76,121,488 H478R probably damaging Het
Btbd1 A T 7: 81,801,056 D325E possibly damaging Het
Camk2a G A 18: 60,957,185 C199Y probably damaging Het
Casp3 A G 8: 46,634,288 D90G probably damaging Het
Ccnt2 A G 1: 127,775,154 H71R probably benign Het
Cdk2ap1 G A 5: 124,348,604 R65* probably null Het
Cebpb G T 2: 167,689,253 A78S probably benign Het
Col5a3 A G 9: 20,771,310 F1613L unknown Het
Cpd T C 11: 76,797,641 D935G probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cwc27 A G 13: 104,804,329 I174T probably damaging Het
Cyp21a1 C A 17: 34,802,404 R331L probably benign Het
Dnah5 A G 15: 28,252,545 T795A probably benign Het
Eif2ak2 A G 17: 78,874,018 V100A possibly damaging Het
Foxa3 A G 7: 19,014,184 V339A probably benign Het
Gp2 T C 7: 119,452,284 D236G probably benign Het
Gzmd T A 14: 56,130,696 H102L probably damaging Het
Klk1b1 A T 7: 43,970,433 I139F probably damaging Het
Lcmt2 G A 2: 121,139,285 P439L probably damaging Het
Loxl4 C T 19: 42,600,007 A570T probably damaging Het
Mga T A 2: 119,919,643 H674Q probably damaging Het
Mybpc3 A T 2: 91,125,370 K583M probably damaging Het
Ncoa6 G T 2: 155,407,713 P1224T probably damaging Het
Nostrin A G 2: 69,180,922 probably null Het
Olfr1264 A T 2: 90,021,538 V176E probably damaging Het
Olfr70 T C 4: 43,697,110 H21R probably benign Het
Oxsr1 A C 9: 119,304,814 D58E possibly damaging Het
Parm1 A G 5: 91,613,064 Y265C probably damaging Het
Phf10 C T 17: 14,952,664 E304K probably damaging Het
Prmt5 T C 14: 54,515,338 T139A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptp4a3 A G 15: 73,752,016 T32A probably benign Het
Pwwp2b A T 7: 139,254,928 D95V possibly damaging Het
Rad51ap2 T C 12: 11,457,751 L558S possibly damaging Het
Rapgef4 A G 2: 72,174,881 D80G probably damaging Het
Sec24a T G 11: 51,712,350 H757P probably damaging Het
Sema4d T C 13: 51,720,535 N129D probably damaging Het
Serpini1 A G 3: 75,623,944 T323A probably benign Het
Setd1a G A 7: 127,785,489 R504H possibly damaging Het
Sftpb T C 6: 72,309,786 C226R probably damaging Het
Sp8 T C 12: 118,848,706 S99P possibly damaging Het
Srgap3 A G 6: 112,771,378 F438L probably damaging Het
Stim2 T C 5: 54,109,814 Y365H probably damaging Het
Stk36 A G 1: 74,634,737 Q1263R probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Troap G T 15: 99,077,586 A184S probably damaging Het
Ttn G A 2: 76,899,327 probably benign Het
Vmn2r108 C A 17: 20,469,101 A531S probably benign Het
Vmn2r12 T A 5: 109,091,474 I408F probably benign Het
Vmn2r8 T A 5: 108,802,303 E226V probably benign Het
Vmo1 A G 11: 70,513,782 F131S probably benign Het
Vwf T C 6: 125,626,341 F885L probably damaging Het
Wdpcp A T 11: 21,857,476 M618L probably benign Het
Wdr90 T C 17: 25,851,741 E1072G probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAATGACCACTTGAATGCCCG -3'
(R):5'- TATCTGGACTGGGATGACTCC -3'

Sequencing Primer
(F):5'- TGCCCGTGCAGGTAAGAAC -3'
(R):5'- ACTGGGATGACTCCTTGGCTC -3'
Posted On2014-10-01