Mutagenetix > Incidental Mutation

Incidental Mutation 'R0197:Utp20'

23506

Institutional Source

Beutler Lab

Gene Symbol

Utp20

Ensembl Gene

ENSMUSG00000004356

Gene Name

UTP20 small subunit processome component

Synonyms

3830408P06Rik, DRIM, mDRIM

MMRRC Submission

038456-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R0197 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88746607-88826804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88777516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1301 (P1301L)

Ref Sequence

ENSEMBL: ENSMUSP00000004470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004470]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000004470
AA Change: P1301L

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: P1301L

Domain	Start	End	E-Value	Type
low complexity region	244	255	N/A	INTRINSIC
low complexity region	442	454	N/A	INTRINSIC
low complexity region	571	581	N/A	INTRINSIC
low complexity region	695	704	N/A	INTRINSIC
Pfam:DRIM	910	1534	2.6e-176	PFAM
low complexity region	1585	1598	N/A	INTRINSIC
low complexity region	1705	1719	N/A	INTRINSIC
low complexity region	2503	2513	N/A	INTRINSIC
low complexity region	2589	2605	N/A	INTRINSIC
low complexity region	2727	2737	N/A	INTRINSIC
low complexity region	2746	2764	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219662

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220275

Meta Mutation Damage Score

0.5290

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 92.5%
20x: 75.9%

Validation Efficiency

97% (121/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
2610507B11Rik	A	C	11: 78,269,704		probably benign	Het
4930452B06Rik	C	T	14: 8,518,695	G254R	probably damaging	Het
Abcc2	A	T	19: 43,826,614	R1147*	probably null	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Aldh9a1	A	G	1: 167,361,847	D388G	probably damaging	Het
Ap3d1	G	T	10: 80,730,042	A97E	probably damaging	Het
Arhgef10	T	A	8: 14,962,636	V320E	probably damaging	Het
Baiap2l1	C	A	5: 144,266,010	V498L	probably damaging	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Col4a3bp	T	A	13: 96,549,287	Y63N	probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Dlx5	T	C	6: 6,881,619	K90E	possibly damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Espnl	T	G	1: 91,344,489	Y524D	probably damaging	Het
Fam20c	T	C	5: 138,755,724	L30P	probably damaging	Het
Fat1	G	T	8: 45,026,553	A2879S	probably benign	Het
Gabrg1	A	T	5: 70,774,389	V337D	probably damaging	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gcc1	T	C	6: 28,420,616	H234R	probably damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Glt6d1	A	G	2: 25,794,070	I308T	probably benign	Het
Gm10320	T	C	13: 98,491,983	T7A	probably benign	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm13088	C	T	4: 143,656,440	E70K	possibly damaging	Het
Gmpr2	T	A	14: 55,672,735	D7E	possibly damaging	Het
Hc	A	G	2: 34,984,750	Y1620H	probably damaging	Het
Hoxa3	T	C	6: 52,170,143		probably benign	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Kdr	G	T	5: 75,968,422	T188N	possibly damaging	Het
Lepr	A	T	4: 101,752,152	D312V	possibly damaging	Het
Mcm3	A	G	1: 20,810,105	V501A	probably damaging	Het
Mcur1	T	C	13: 43,545,740	Y267C	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mroh2a	G	C	1: 88,246,042	A871P	probably damaging	Het
Ndrg2	T	A	14: 51,907,003		probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Onecut2	T	A	18: 64,341,472	S365T	possibly damaging	Het
Pds5b	C	A	5: 150,754,431	Q505K	probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Samd3	T	A	10: 26,271,854	C476S	possibly damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Smpd4	T	A	16: 17,641,597		probably null	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Svep1	T	C	4: 58,070,851	K2312E	possibly damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Usp24	T	A	4: 106,407,133	W1754R	probably damaging	Het
Vmn2r115	T	A	17: 23,359,781	S743T	probably damaging	Het
Vps41	T	G	13: 18,854,663		probably null	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Utp20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Utp20	APN	10	88825444	missense	possibly damaging	0.90
IGL00858:Utp20	APN	10	88809125	missense	possibly damaging	0.69
IGL00858:Utp20	APN	10	88809138	missense	probably benign
IGL00946:Utp20	APN	10	88748315	missense	possibly damaging	0.82
IGL01061:Utp20	APN	10	88770704	missense	probably benign	0.13
IGL01399:Utp20	APN	10	88758302	critical splice donor site	probably null
IGL01548:Utp20	APN	10	88764781	missense	probably damaging	1.00
IGL01587:Utp20	APN	10	88787535	missense	probably damaging	0.98
IGL01789:Utp20	APN	10	88798279	critical splice donor site	probably null
IGL01819:Utp20	APN	10	88792687	missense	probably damaging	1.00
IGL02070:Utp20	APN	10	88821877	splice site	probably benign
IGL02231:Utp20	APN	10	88791168	missense	probably damaging	1.00
IGL02244:Utp20	APN	10	88815956	splice site	probably benign
IGL02367:Utp20	APN	10	88771853	unclassified	probably benign
IGL02553:Utp20	APN	10	88764795	missense	probably damaging	0.99
IGL02748:Utp20	APN	10	88817295	missense	probably benign	0.00
IGL02831:Utp20	APN	10	88815908	missense	probably benign
IGL02986:Utp20	APN	10	88775285	missense	probably damaging	1.00
IGL02997:Utp20	APN	10	88814034	missense	probably benign
IGL03105:Utp20	APN	10	88791096	missense	probably benign	0.10
IGL03251:Utp20	APN	10	88817326	critical splice acceptor site	probably null
IGL03337:Utp20	APN	10	88754566	missense	probably benign
IGL03348:Utp20	APN	10	88758317	missense	probably benign	0.09
IGL03381:Utp20	APN	10	88822005	missense	probably damaging	0.99
Bell	UTSW	10	88792625	missense	probably benign	0.29
elite	UTSW	10	88770808	missense	probably benign
Margin	UTSW	10	88768679	missense	probably benign	0.04
Percentile	UTSW	10	88775318	missense	probably damaging	1.00
R0037:Utp20	UTSW	10	88798404	missense	probably benign	0.05
R0107:Utp20	UTSW	10	88778391	missense	probably benign	0.03
R0219:Utp20	UTSW	10	88764675	missense	probably damaging	1.00
R0315:Utp20	UTSW	10	88807421	missense	probably damaging	1.00
R0328:Utp20	UTSW	10	88767107	missense	possibly damaging	0.82
R0329:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0330:Utp20	UTSW	10	88817979	missense	probably benign	0.00
R0395:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R0399:Utp20	UTSW	10	88820979	missense	probably damaging	1.00
R0454:Utp20	UTSW	10	88822069	missense	probably benign	0.00
R0456:Utp20	UTSW	10	88754573	missense	possibly damaging	0.92
R0491:Utp20	UTSW	10	88760912	missense	probably damaging	1.00
R0557:Utp20	UTSW	10	88748311	missense	probably damaging	0.99
R0600:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R0616:Utp20	UTSW	10	88770751	missense	probably benign	0.14
R1076:Utp20	UTSW	10	88772459	missense	probably benign	0.36
R1076:Utp20	UTSW	10	88772543	missense	possibly damaging	0.86
R1330:Utp20	UTSW	10	88801189	missense	probably damaging	0.96
R1440:Utp20	UTSW	10	88819339	missense	probably benign	0.19
R1529:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R1554:Utp20	UTSW	10	88764737	nonsense	probably null
R1621:Utp20	UTSW	10	88762871	missense	probably benign
R1641:Utp20	UTSW	10	88757972	missense	possibly damaging	0.82
R1709:Utp20	UTSW	10	88749297	missense	probably benign	0.29
R1734:Utp20	UTSW	10	88767461	missense	probably damaging	1.00
R1755:Utp20	UTSW	10	88809769	missense	probably benign	0.01
R1775:Utp20	UTSW	10	88770808	missense	probably benign
R1866:Utp20	UTSW	10	88762770	nonsense	probably null
R1867:Utp20	UTSW	10	88749443	missense	probably benign
R1901:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1902:Utp20	UTSW	10	88753026	missense	probably benign	0.02
R1967:Utp20	UTSW	10	88816979	missense	probably benign	0.03
R2060:Utp20	UTSW	10	88774795	missense	probably damaging	0.98
R2102:Utp20	UTSW	10	88772917	missense	probably damaging	0.99
R2110:Utp20	UTSW	10	88767451	critical splice donor site	probably null
R2115:Utp20	UTSW	10	88786003	missense	probably benign	0.02
R2128:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2129:Utp20	UTSW	10	88814055	missense	probably damaging	0.99
R2180:Utp20	UTSW	10	88820939	missense	probably damaging	0.98
R2280:Utp20	UTSW	10	88825503	splice site	probably null
R2435:Utp20	UTSW	10	88820891	missense	possibly damaging	0.89
R2914:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R3005:Utp20	UTSW	10	88777455	missense	probably damaging	0.97
R3546:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3547:Utp20	UTSW	10	88782689	missense	probably damaging	1.00
R3622:Utp20	UTSW	10	88757993	unclassified	probably benign
R3737:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3738:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R3841:Utp20	UTSW	10	88775203	unclassified	probably benign
R4034:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4035:Utp20	UTSW	10	88762806	missense	probably benign	0.00
R4157:Utp20	UTSW	10	88761867	missense	probably benign
R4243:Utp20	UTSW	10	88807325	critical splice donor site	probably null
R4295:Utp20	UTSW	10	88754519	missense	possibly damaging	0.54
R4632:Utp20	UTSW	10	88778261	missense	probably damaging	1.00
R4633:Utp20	UTSW	10	88752952	missense	probably benign
R4684:Utp20	UTSW	10	88807445	nonsense	probably null
R4731:Utp20	UTSW	10	88754520	missense	possibly damaging	0.93
R4735:Utp20	UTSW	10	88816918	missense	possibly damaging	0.91
R4772:Utp20	UTSW	10	88809935	missense	probably benign	0.09
R4912:Utp20	UTSW	10	88771960	missense	probably benign	0.01
R4974:Utp20	UTSW	10	88816949	missense	probably benign	0.08
R4991:Utp20	UTSW	10	88746934	missense	probably benign	0.09
R5004:Utp20	UTSW	10	88748273	missense	probably damaging	0.98
R5037:Utp20	UTSW	10	88775330	missense	probably benign	0.00
R5043:Utp20	UTSW	10	88798746	missense	possibly damaging	0.70
R5108:Utp20	UTSW	10	88768873	missense	probably benign	0.00
R5138:Utp20	UTSW	10	88747377	missense	probably damaging	0.96
R5252:Utp20	UTSW	10	88750670	missense	probably benign	0.01
R5394:Utp20	UTSW	10	88772915	nonsense	probably null
R5470:Utp20	UTSW	10	88817896	missense	probably benign	0.14
R5558:Utp20	UTSW	10	88751467	missense	probably damaging	1.00
R5678:Utp20	UTSW	10	88809117	missense	probably benign	0.00
R5822:Utp20	UTSW	10	88817285	missense	probably benign	0.00
R5866:Utp20	UTSW	10	88772559	missense	possibly damaging	0.82
R5924:Utp20	UTSW	10	88815922	missense	probably benign	0.00
R6026:Utp20	UTSW	10	88768679	missense	probably benign	0.04
R6363:Utp20	UTSW	10	88757080	missense	probably damaging	1.00
R6434:Utp20	UTSW	10	88772533	nonsense	probably null
R6477:Utp20	UTSW	10	88768918	missense	probably benign	0.05
R6480:Utp20	UTSW	10	88755186	critical splice donor site	probably null
R6989:Utp20	UTSW	10	88778240	missense	probably benign	0.00
R7033:Utp20	UTSW	10	88754475	critical splice donor site	probably null
R7192:Utp20	UTSW	10	88772459	missense	probably benign	0.09
R7236:Utp20	UTSW	10	88749342	missense	probably benign	0.28
R7260:Utp20	UTSW	10	88751472	missense	probably benign	0.39
R7296:Utp20	UTSW	10	88770724	missense	probably benign	0.21
R7317:Utp20	UTSW	10	88762935	missense	possibly damaging	0.83
R7318:Utp20	UTSW	10	88813949	missense	possibly damaging	0.89
R7330:Utp20	UTSW	10	88787562	frame shift	probably null
R7367:Utp20	UTSW	10	88795443	missense	probably benign	0.21
R7432:Utp20	UTSW	10	88798398	missense	probably benign	0.00
R7447:Utp20	UTSW	10	88772492	missense	probably damaging	1.00
R7473:Utp20	UTSW	10	88820710	splice site	probably null
R7520:Utp20	UTSW	10	88818595	missense	probably damaging	1.00
R7530:Utp20	UTSW	10	88753006	missense	probably damaging	1.00
R7539:Utp20	UTSW	10	88791745	missense	probably damaging	1.00
R7651:Utp20	UTSW	10	88754595	missense	probably benign	0.41
R7728:Utp20	UTSW	10	88798341	missense	probably damaging	1.00
R7831:Utp20	UTSW	10	88762770	nonsense	probably null
R7833:Utp20	UTSW	10	88801136	missense	possibly damaging	0.92
R7909:Utp20	UTSW	10	88775330	missense	probably benign
R7956:Utp20	UTSW	10	88782614	missense	probably benign	0.23
R7999:Utp20	UTSW	10	88770388	missense	probably benign
R8080:Utp20	UTSW	10	88782715	missense	possibly damaging	0.82
R8098:Utp20	UTSW	10	88752948	missense	probably benign	0.13
R8104:Utp20	UTSW	10	88757904	missense	probably damaging	1.00
R8129:Utp20	UTSW	10	88792625	missense	probably benign	0.29
R8147:Utp20	UTSW	10	88758444	missense	probably benign	0.02
R8199:Utp20	UTSW	10	88798475	missense	probably benign
R8222:Utp20	UTSW	10	88778372	missense	probably damaging	1.00
R8415:Utp20	UTSW	10	88826604	critical splice donor site	probably null
R8466:Utp20	UTSW	10	88818503	missense	probably damaging	1.00
R8505:Utp20	UTSW	10	88818008	missense	probably benign	0.03
R8774:Utp20	UTSW	10	88752901	splice site	probably benign
R8802:Utp20	UTSW	10	88747295	missense	probably damaging	1.00
R8923:Utp20	UTSW	10	88791742	nonsense	probably null
R8945:Utp20	UTSW	10	88792670	nonsense	probably null
R9065:Utp20	UTSW	10	88757110	missense	probably benign	0.32
R9092:Utp20	UTSW	10	88768817	missense	probably benign
R9092:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9094:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9095:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9096:Utp20	UTSW	10	88775318	missense	probably damaging	1.00
R9229:Utp20	UTSW	10	88758377	missense	possibly damaging	0.86
R9323:Utp20	UTSW	10	88747308	missense	probably damaging	1.00
R9336:Utp20	UTSW	10	88813936	missense	probably damaging	1.00
R9467:Utp20	UTSW	10	88804528	missense	possibly damaging	0.68
R9545:Utp20	UTSW	10	88782649	missense	probably benign	0.38
R9659:Utp20	UTSW	10	88817309	missense	probably damaging	1.00
R9788:Utp20	UTSW	10	88817309	missense	probably damaging	1.00
RF005:Utp20	UTSW	10	88825457	missense	probably damaging	1.00
RF024:Utp20	UTSW	10	88825457	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCACTCATAGAGAGCTACACTCC -3'
(R):5'- CGGCGGTTCCTGTACTGTAATAAGG -3'

Sequencing Primer
(F):5'- GCTGGAGATTAGACCCAGTACC -3'
(R):5'- gaacagccattgctcttaacc -3'

Posted On

2013-04-16