Incidental Mutation 'R2160:Braf'
ID235099
Institutional Source Beutler Lab
Gene Symbol Braf
Ensembl Gene ENSMUSG00000002413
Gene NameBraf transforming gene
SynonymsBraf-2, D6Ertd631e, 9930012E13Rik, Braf2
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location39603237-39725463 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39662073 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 248 (C248Y)
Ref Sequence ENSEMBL: ENSMUSP00000002487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002487] [ENSMUST00000101497]
Predicted Effect probably damaging
Transcript: ENSMUST00000002487
AA Change: C248Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002487
Gene: ENSMUSG00000002413
AA Change: C248Y

DomainStartEndE-ValueType
low complexity region 5 30 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
coiled coil region 94 121 N/A INTRINSIC
RBD 139 211 1.04e-33 SMART
C1 219 264 1.05e-13 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 316 326 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
Pfam:Pkinase_Tyr 494 751 9.6e-65 PFAM
Pfam:Pkinase 494 753 5.1e-60 PFAM
Pfam:Kinase-like 573 741 3e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101497
AA Change: C247Y

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099036
Gene: ENSMUSG00000002413
AA Change: C247Y

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
coiled coil region 60 88 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
RBD 138 210 1.04e-33 SMART
C1 218 263 1.05e-13 SMART
low complexity region 296 310 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
low complexity region 406 421 N/A INTRINSIC
Pfam:Pkinase 441 698 8.2e-62 PFAM
Pfam:Pkinase_Tyr 441 698 1.5e-65 PFAM
Pfam:Kinase-like 523 688 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169647
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in this gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis, are smaller, have enlarged blood vessels, hemorrhaging, poor circulation, slow heartbeat and abnormal endothelial cell development. Mice homozygous for a targeted allele activated in neurons exhibit impaired neuronal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Braf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Braf APN 6 39660999 splice site probably null
IGL01616:Braf APN 6 39651652 missense probably damaging 1.00
IGL01621:Braf APN 6 39646853 intron probably benign
IGL01825:Braf APN 6 39639590 missense probably damaging 0.99
IGL02435:Braf APN 6 39646766 missense probably benign 0.00
IGL02629:Braf APN 6 39688299 missense possibly damaging 0.83
IGL02751:Braf APN 6 39660867 splice site probably benign
IGL02829:Braf APN 6 39627728 missense possibly damaging 0.62
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0041:Braf UTSW 6 39640479 missense probably damaging 1.00
R0497:Braf UTSW 6 39640549 splice site probably benign
R0512:Braf UTSW 6 39664989 splice site probably benign
R0604:Braf UTSW 6 39623697 missense probably damaging 1.00
R0726:Braf UTSW 6 39662148 missense possibly damaging 0.90
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1468:Braf UTSW 6 39665083 missense probably damaging 1.00
R1616:Braf UTSW 6 39643133 missense probably benign 0.35
R3722:Braf UTSW 6 39623676 missense probably damaging 1.00
R4407:Braf UTSW 6 39615720 missense probably damaging 1.00
R4540:Braf UTSW 6 39644333 missense probably damaging 1.00
R5026:Braf UTSW 6 39688287 missense probably benign 0.22
R5478:Braf UTSW 6 39677574 missense possibly damaging 0.94
R6284:Braf UTSW 6 39688282 missense possibly damaging 0.73
R6993:Braf UTSW 6 39643163 missense probably damaging 1.00
R7251:Braf UTSW 6 39677570 critical splice donor site probably null
R7385:Braf UTSW 6 39665108 critical splice acceptor site probably null
R7483:Braf UTSW 6 39627838 missense possibly damaging 0.86
R7511:Braf UTSW 6 39688253 missense probably damaging 0.99
Z1088:Braf UTSW 6 39662026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTGCGTGGACTATTCG -3'
(R):5'- ATGGGATAGTATTTCAAGTCCCTTG -3'

Sequencing Primer
(F):5'- ATTCTTTAGCAATTGCATTGGGC -3'
(R):5'- TCAAGTCCCTTGGTTTTAATATTGTG -3'
Posted On2014-10-01