Incidental Mutation 'R2160:Vmn1r7'
ID235100
Institutional Source Beutler Lab
Gene Symbol Vmn1r7
Ensembl Gene ENSMUSG00000093696
Gene Namevomeronasal 1 receptor 7
SynonymsGm5568, V1rc31
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57024106-57025324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57024894 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 127 (F127S)
Ref Sequence ENSEMBL: ENSMUSP00000135571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176252]
Predicted Effect probably damaging
Transcript: ENSMUST00000176252
AA Change: F127S

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135571
Gene: ENSMUSG00000093696
AA Change: F127S

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.1e-59 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Vmn1r7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Vmn1r7 APN 6 57024723 missense probably damaging 1.00
IGL01528:Vmn1r7 APN 6 57024547 missense probably benign
IGL02024:Vmn1r7 APN 6 57024889 missense probably benign 0.01
IGL02234:Vmn1r7 APN 6 57024552 missense probably damaging 0.98
IGL02610:Vmn1r7 APN 6 57025052 missense probably benign 0.01
IGL02691:Vmn1r7 APN 6 57024388 missense probably benign 0.05
R0529:Vmn1r7 UTSW 6 57024465 missense possibly damaging 0.78
R0548:Vmn1r7 UTSW 6 57025081 missense probably damaging 0.96
R1254:Vmn1r7 UTSW 6 57024787 missense probably damaging 1.00
R1279:Vmn1r7 UTSW 6 57024949 missense possibly damaging 0.63
R1582:Vmn1r7 UTSW 6 57025158 missense probably damaging 1.00
R1973:Vmn1r7 UTSW 6 57025026 missense probably benign 0.00
R1991:Vmn1r7 UTSW 6 57024868 missense probably benign 0.37
R3546:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R3547:Vmn1r7 UTSW 6 57024849 missense possibly damaging 0.80
R5901:Vmn1r7 UTSW 6 57024606 missense probably damaging 1.00
R6294:Vmn1r7 UTSW 6 57024419 missense probably benign 0.00
R7063:Vmn1r7 UTSW 6 57024433 missense possibly damaging 0.63
R7192:Vmn1r7 UTSW 6 57024467 missense probably benign 0.00
R7647:Vmn1r7 UTSW 6 57025270 missense probably benign 0.01
R7781:Vmn1r7 UTSW 6 57024568 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCAGCATGACTCCTACCAG -3'
(R):5'- TGCTTGCAGACATATTTGAGTCAC -3'

Sequencing Primer
(F):5'- CAGAAACACATCTCTGGAGATTG -3'
(R):5'- GTCACTGAACATTGGGAATGACTTC -3'
Posted On2014-10-01