Mutagenetix > Incidental Mutation

Incidental Mutation 'R2160:Cntnap4'

235115

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

Caspr4, E130114F09Rik

MMRRC Submission

040163-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R2160 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113296675-113609349 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 113484203 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 419 (G419C)

Ref Sequence

ENSEMBL: ENSMUSP00000112511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: G419C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: G419C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125196

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125976

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	G	2: 154,161,595 (GRCm39)	N576D	possibly damaging	Het
Braf	C	T	6: 39,639,007 (GRCm39)	C248Y	probably damaging	Het
Carmil2	A	G	8: 106,423,680 (GRCm39)	E1218G	possibly damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,604,632 (GRCm39)		probably null	Het
Dnah9	C	T	11: 66,008,309 (GRCm39)	D839N	probably damaging	Het
Evc2	A	G	5: 37,537,862 (GRCm39)	T517A	possibly damaging	Het
Fbxw8	G	A	5: 118,263,053 (GRCm39)	P209S	probably damaging	Het
Gcm1	A	G	9: 77,968,662 (GRCm39)	K121E	probably benign	Het
Gprc6a	CAAA	CA	10: 51,491,776 (GRCm39)		probably null	Het
Herc2	A	G	7: 55,862,670 (GRCm39)	D4077G	probably benign	Het
Inpp4b	T	A	8: 82,848,004 (GRCm39)	L937*	probably null	Het
Ipcef1	A	T	10: 6,840,650 (GRCm39)	I349N	probably damaging	Het
Ipmk	A	G	10: 71,217,256 (GRCm39)	T267A	probably benign	Het
Jph3	G	T	8: 122,479,970 (GRCm39)	R216L	possibly damaging	Het
Kctd16	A	G	18: 40,392,138 (GRCm39)	E242G	probably damaging	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Krt76	A	G	15: 101,796,820 (GRCm39)	Y360H	probably damaging	Het
Lctl	A	G	9: 64,025,049 (GRCm39)	I12V	probably benign	Het
Lrig3	T	C	10: 125,833,565 (GRCm39)	V347A	possibly damaging	Het
Lrrk2	C	T	15: 91,680,263 (GRCm39)	S2058F	probably damaging	Het
Mark2	G	C	19: 7,260,112 (GRCm39)	S111C	probably damaging	Het
Mon2	T	A	10: 122,911,834 (GRCm39)	K12*	probably null	Het
Nup58	A	G	14: 60,476,957 (GRCm39)	V238A	probably benign	Het
Pak5	T	C	2: 135,940,302 (GRCm39)	D504G	probably benign	Het
Pla2g4e	T	C	2: 120,015,687 (GRCm39)	S286G	probably benign	Het
Ppfia4	A	T	1: 134,241,461 (GRCm39)	V498D	probably benign	Het
Ppfibp1	A	G	6: 146,928,951 (GRCm39)	E846G	probably damaging	Het
Ppp3ca	G	A	3: 136,583,391 (GRCm39)	C166Y	probably damaging	Het
Prpf3	T	C	3: 95,752,542 (GRCm39)	K244E	probably benign	Het
Pzp	A	G	6: 128,502,239 (GRCm39)	S37P	probably damaging	Het
Rab11fip3	G	A	17: 26,288,028 (GRCm39)	H42Y	probably benign	Het
Sprn	C	A	7: 139,733,419 (GRCm39)		probably benign	Het
Tectb	C	G	19: 55,169,431 (GRCm39)		probably benign	Het
Thap12	A	G	7: 98,359,333 (GRCm39)	S71G	probably damaging	Het
Vmn1r7	A	G	6: 57,001,879 (GRCm39)	F127S	probably damaging	Het
Vmn2r54	C	T	7: 12,349,420 (GRCm39)	V721I	probably benign	Het
Vmn2r56	A	G	7: 12,428,146 (GRCm39)	F707L	probably benign	Het
Zfp976	C	T	7: 42,263,354 (GRCm39)	S161N	probably benign	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	113,494,251 (GRCm39)	splice site	probably benign
IGL01898:Cntnap4	APN	8	113,582,939 (GRCm39)	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	113,478,866 (GRCm39)	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	113,343,126 (GRCm39)	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	113,512,535 (GRCm39)	splice site	probably benign
IGL02621:Cntnap4	APN	8	113,537,355 (GRCm39)	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	113,500,222 (GRCm39)	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	113,500,208 (GRCm39)	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	113,529,796 (GRCm39)	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	113,512,416 (GRCm39)	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	113,569,148 (GRCm39)	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	113,583,143 (GRCm39)	nonsense	probably null
R0497:Cntnap4	UTSW	8	113,296,783 (GRCm39)	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	113,608,395 (GRCm39)	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	113,608,462 (GRCm39)	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	113,484,155 (GRCm39)	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	113,542,128 (GRCm39)	missense	probably benign	0.10
R2226:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	113,484,071 (GRCm39)	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	113,602,165 (GRCm39)	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	113,478,939 (GRCm39)	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	113,480,554 (GRCm39)	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	113,391,898 (GRCm39)	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	113,584,842 (GRCm39)	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	113,537,240 (GRCm39)	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	113,537,342 (GRCm39)	missense	probably benign
R4611:Cntnap4	UTSW	8	113,500,371 (GRCm39)	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	113,512,468 (GRCm39)	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	113,500,222 (GRCm39)	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	113,460,070 (GRCm39)	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	113,568,385 (GRCm39)	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	113,602,061 (GRCm39)	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	113,569,353 (GRCm39)	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	113,529,843 (GRCm39)	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	113,478,921 (GRCm39)	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	113,484,105 (GRCm39)	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	113,529,858 (GRCm39)	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	113,584,874 (GRCm39)	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	113,542,120 (GRCm39)	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	113,537,268 (GRCm39)	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	113,608,432 (GRCm39)	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	113,391,731 (GRCm39)	splice site	probably null
R7348:Cntnap4	UTSW	8	113,391,909 (GRCm39)	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	113,460,194 (GRCm39)	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	113,484,113 (GRCm39)	missense	probably benign
R7895:Cntnap4	UTSW	8	113,478,829 (GRCm39)	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	113,480,577 (GRCm39)	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	113,391,897 (GRCm39)	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	113,296,857 (GRCm39)	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	113,500,324 (GRCm39)	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	113,484,228 (GRCm39)	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	113,529,820 (GRCm39)	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	113,585,759 (GRCm39)	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	113,479,598 (GRCm39)	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	113,479,646 (GRCm39)	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	113,602,600 (GRCm39)	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	113,500,276 (GRCm39)	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	113,460,103 (GRCm39)	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	113,582,982 (GRCm39)	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	113,602,181 (GRCm39)	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	113,568,349 (GRCm39)	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	113,391,808 (GRCm39)	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	113,568,496 (GRCm39)	missense	probably damaging	0.97
R9765:Cntnap4	UTSW	8	113,484,110 (GRCm39)	missense	probably benign	0.00
R9793:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	113,608,357 (GRCm39)	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	113,585,775 (GRCm39)	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	113,602,211 (GRCm39)	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	113,542,152 (GRCm39)	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	113,584,821 (GRCm39)	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	113,479,002 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCCTCAGGGAAATGCCTC -3'
(R):5'- TGGATGGAAATTTCTACTCCCTC -3'

Sequencing Primer
(F):5'- AGGGAAATGCCTCCTTTTCTTG -3'
(R):5'- TCCTCTAAGGAAAGGTACTGATAATC -3'

Posted On

2014-10-01