Incidental Mutation 'R2160:Cntnap4'
ID235115
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Namecontactin associated protein-like 4
SynonymsE130114F09Rik, Caspr4
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location112570043-112882717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 112757571 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 419 (G419C)
Ref Sequence ENSEMBL: ENSMUSP00000112511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
Predicted Effect probably damaging
Transcript: ENSMUST00000034225
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: G419C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118171
AA Change: G419C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: G419C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125976
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 112767619 splice site probably benign
IGL01898:Cntnap4 APN 8 112856307 missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 112752234 missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 112616494 missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 112785903 splice site probably benign
IGL02621:Cntnap4 APN 8 112810723 missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 112773590 missense probably benign 0.06
IGL03327:Cntnap4 APN 8 112773576 missense probably benign 0.00
IGL03346:Cntnap4 APN 8 112773576 missense probably benign 0.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 112803164 missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 112785784 missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 112842516 critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 112856511 nonsense probably null
R0497:Cntnap4 UTSW 8 112570151 missense probably benign 0.00
R1495:Cntnap4 UTSW 8 112881763 missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 112881830 missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 112757523 missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 112815496 missense probably benign 0.10
R2226:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 112757439 missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R3917:Cntnap4 UTSW 8 112875533 missense probably benign 0.02
R4097:Cntnap4 UTSW 8 112752307 missense probably benign 0.03
R4348:Cntnap4 UTSW 8 112753922 missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 112665266 missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 112858210 missense probably benign 0.32
R4531:Cntnap4 UTSW 8 112810608 missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 112810710 missense probably benign
R4611:Cntnap4 UTSW 8 112773739 critical splice donor site probably null
R4675:Cntnap4 UTSW 8 112785836 missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 112773590 missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 112733438 missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 112841753 missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 112875429 missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 112842721 missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 112803211 missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 112752289 missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 112757473 missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 112803226 missense probably benign 0.03
R7031:Cntnap4 UTSW 8 112858242 missense probably benign 0.01
R7107:Cntnap4 UTSW 8 112815488 missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 112810636 missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 112881800 missense probably benign 0.05
R7232:Cntnap4 UTSW 8 112665099 splice site probably null
R7348:Cntnap4 UTSW 8 112665277 missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 112733562 critical splice donor site probably null
R7832:Cntnap4 UTSW 8 112757481 missense probably benign
R7895:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R7915:Cntnap4 UTSW 8 112757481 missense probably benign
R7978:Cntnap4 UTSW 8 112752197 missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 112753945 missense probably damaging 0.99
X0025:Cntnap4 UTSW 8 112859143 missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 112875579 missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 112815520 missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 112858189 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGTCCTCAGGGAAATGCCTC -3'
(R):5'- TGGATGGAAATTTCTACTCCCTC -3'

Sequencing Primer
(F):5'- AGGGAAATGCCTCCTTTTCTTG -3'
(R):5'- TCCTCTAAGGAAAGGTACTGATAATC -3'
Posted On2014-10-01