Mutagenetix > Incidental Mutations

Incidental Mutation 'R2160:Jph3'

235116

Institutional Source

Beutler Lab

Gene Symbol

Jph3

Ensembl Gene

ENSMUSG00000025318

Gene Name

junctophilin 3

Synonyms

JP-3

MMRRC Submission

040163-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.316) question?

Stock #

R2160 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

121729623-121794276 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121753231 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 216 (R216L)

Ref Sequence

ENSEMBL: ENSMUSP00000126190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026357] [ENSMUST00000127664] [ENSMUST00000167439]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026357
AA Change: R216L

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026357
Gene: ENSMUSG00000025318
AA Change: R216L

Domain	Start	End	E-Value	Type
MORN	13	34	8.01e-1	SMART
MORN	37	57	6.13e1	SMART
MORN	59	80	2.99e-1	SMART
Pfam:MORN	83	104	5.9e-2	PFAM
MORN	105	126	8.1e-5	SMART
MORN	128	149	2.74e-2	SMART
low complexity region	181	192	N/A	INTRINSIC
low complexity region	212	244	N/A	INTRINSIC
MORN	286	307	2.78e-3	SMART
MORN	309	330	1.03e-6	SMART
low complexity region	360	381	N/A	INTRINSIC
low complexity region	393	409	N/A	INTRINSIC
low complexity region	481	494	N/A	INTRINSIC
transmembrane domain	721	743	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167439
AA Change: R216L

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126190
Gene: ENSMUSG00000025318
AA Change: R216L

Domain	Start	End	E-Value	Type
MORN	13	34	8.01e-1	SMART
MORN	37	57	6.13e1	SMART
MORN	59	80	2.99e-1	SMART
Pfam:MORN	83	104	5.8e-2	PFAM
MORN	105	126	8.1e-5	SMART
MORN	128	149	2.74e-2	SMART
low complexity region	181	192	N/A	INTRINSIC
low complexity region	212	244	N/A	INTRINSIC
MORN	286	307	2.78e-3	SMART
MORN	309	330	1.03e-6	SMART
low complexity region	360	381	N/A	INTRINSIC
low complexity region	393	409	N/A	INTRINSIC
low complexity region	481	494	N/A	INTRINSIC
transmembrane domain	721	743	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172209

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired balance and motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	G	2: 154,319,675	N576D	possibly damaging	Het
Braf	C	T	6: 39,662,073	C248Y	probably damaging	Het
Carmil2	A	G	8: 105,697,048	E1218G	possibly damaging	Het
Cntnap4	G	T	8: 112,757,571	G419C	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Dnah9	C	T	11: 66,117,483	D839N	probably damaging	Het
Evc2	A	G	5: 37,380,518	T517A	possibly damaging	Het
Fbxw8	G	A	5: 118,124,988	P209S	probably damaging	Het
Gcm1	A	G	9: 78,061,380	K121E	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Herc2	A	G	7: 56,212,922	D4077G	probably benign	Het
Inpp4b	T	A	8: 82,121,375	L937*	probably null	Het
Ipcef1	A	T	10: 6,890,650	I349N	probably damaging	Het
Ipmk	A	G	10: 71,381,426	T267A	probably benign	Het
Kctd16	A	G	18: 40,259,085	E242G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Krt76	A	G	15: 101,888,385	Y360H	probably damaging	Het
Lctl	A	G	9: 64,117,767	I12V	probably benign	Het
Lrig3	T	C	10: 125,997,696	V347A	possibly damaging	Het
Lrrk2	C	T	15: 91,796,060	S2058F	probably damaging	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mon2	T	A	10: 123,075,929	K12*	probably null	Het
Nupl1	A	G	14: 60,239,508	V238A	probably benign	Het
Pak7	T	C	2: 136,098,382	D504G	probably benign	Het
Pla2g4e	T	C	2: 120,185,206	S286G	probably benign	Het
Ppfia4	A	T	1: 134,313,723	V498D	probably benign	Het
Ppfibp1	A	G	6: 147,027,453	E846G	probably damaging	Het
Ppp3ca	G	A	3: 136,877,630	C166Y	probably damaging	Het
Prpf3	T	C	3: 95,845,230	K244E	probably benign	Het
Pzp	A	G	6: 128,525,276	S37P	probably damaging	Het
Rab11fip3	G	A	17: 26,069,054	H42Y	probably benign	Het
Sprn	C	A	7: 140,153,506		probably benign	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thap12	A	G	7: 98,710,126	S71G	probably damaging	Het
Vmn1r7	A	G	6: 57,024,894	F127S	probably damaging	Het
Vmn2r54	C	T	7: 12,615,493	V721I	probably benign	Het
Vmn2r56	A	G	7: 12,694,219	F707L	probably benign	Het
Zfp976	C	T	7: 42,613,930	S161N	probably benign	Het

Other mutations in Jph3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02976:Jph3	APN	8	121753084	missense	probably damaging	1.00
R0142:Jph3	UTSW	8	121753371	missense	possibly damaging	0.84
R0200:Jph3	UTSW	8	121784833	missense	probably benign	0.36
R0238:Jph3	UTSW	8	121753720	missense	possibly damaging	0.83
R0238:Jph3	UTSW	8	121753720	missense	possibly damaging	0.83
R1550:Jph3	UTSW	8	121784859	missense	possibly damaging	0.74
R2127:Jph3	UTSW	8	121785142	missense	probably benign	0.09
R3901:Jph3	UTSW	8	121753419	missense	possibly damaging	0.64
R3902:Jph3	UTSW	8	121753419	missense	possibly damaging	0.64
R5126:Jph3	UTSW	8	121753048	missense	possibly damaging	0.70
R6073:Jph3	UTSW	8	121753552	missense	probably damaging	1.00
R6130:Jph3	UTSW	8	121753087	missense	probably damaging	0.98
R6794:Jph3	UTSW	8	121785385	missense	probably benign	0.10
R6923:Jph3	UTSW	8	121753371	missense	possibly damaging	0.84
R7337:Jph3	UTSW	8	121753702	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGAGGACCTCCATCAACTCC -3'
(R):5'- CTTCCATTCACCCACGTAGG -3'

Sequencing Primer
(F):5'- TCCATCAACTCCCTGCGCAG -3'
(R):5'- GATGTCGTCCTCAATGACCG -3'

Posted On

2014-10-01