Incidental Mutation 'R2160:Gprc6a'
ID235120
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene NameG protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 040163-MU
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2160 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location51614823-51631461 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAA to CA at 51615680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
Predicted Effect probably null
Transcript: ENSMUST00000020062
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218684
Predicted Effect probably null
Transcript: ENSMUST00000219286
Meta Mutation Damage Score 0.6248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAATGACCACTTGAATGCCCG -3'
(R):5'- TATCTGGACTGGGATGACTCC -3'

Sequencing Primer
(F):5'- TGCCCGTGCAGGTAAGAAC -3'
(R):5'- ACTGGGATGACTCCTTGGCTC -3'
Posted On2014-10-01