Mutagenetix > Incidental Mutations

Incidental Mutation 'R2160:Krt76'

235132

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

040163-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2160 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101888385 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 360 (Y360H)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100179
AA Change: Y360H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: Y360H

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bpifb9b	A	G	2: 154,319,675	N576D	possibly damaging	Het
Braf	C	T	6: 39,662,073	C248Y	probably damaging	Het
Carmil2	A	G	8: 105,697,048	E1218G	possibly damaging	Het
Cntnap4	G	T	8: 112,757,571	G419C	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Dnah9	C	T	11: 66,117,483	D839N	probably damaging	Het
Evc2	A	G	5: 37,380,518	T517A	possibly damaging	Het
Fbxw8	G	A	5: 118,124,988	P209S	probably damaging	Het
Gcm1	A	G	9: 78,061,380	K121E	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Herc2	A	G	7: 56,212,922	D4077G	probably benign	Het
Inpp4b	T	A	8: 82,121,375	L937*	probably null	Het
Ipcef1	A	T	10: 6,890,650	I349N	probably damaging	Het
Ipmk	A	G	10: 71,381,426	T267A	probably benign	Het
Jph3	G	T	8: 121,753,231	R216L	possibly damaging	Het
Kctd16	A	G	18: 40,259,085	E242G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lctl	A	G	9: 64,117,767	I12V	probably benign	Het
Lrig3	T	C	10: 125,997,696	V347A	possibly damaging	Het
Lrrk2	C	T	15: 91,796,060	S2058F	probably damaging	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mon2	T	A	10: 123,075,929	K12*	probably null	Het
Nupl1	A	G	14: 60,239,508	V238A	probably benign	Het
Pak7	T	C	2: 136,098,382	D504G	probably benign	Het
Pla2g4e	T	C	2: 120,185,206	S286G	probably benign	Het
Ppfia4	A	T	1: 134,313,723	V498D	probably benign	Het
Ppfibp1	A	G	6: 147,027,453	E846G	probably damaging	Het
Ppp3ca	G	A	3: 136,877,630	C166Y	probably damaging	Het
Prpf3	T	C	3: 95,845,230	K244E	probably benign	Het
Pzp	A	G	6: 128,525,276	S37P	probably damaging	Het
Rab11fip3	G	A	17: 26,069,054	H42Y	probably benign	Het
Sprn	C	A	7: 140,153,506		probably benign	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Thap12	A	G	7: 98,710,126	S71G	probably damaging	Het
Vmn1r7	A	G	6: 57,024,894	F127S	probably damaging	Het
Vmn2r54	C	T	7: 12,615,493	V721I	probably benign	Het
Vmn2r56	A	G	7: 12,694,219	F707L	probably benign	Het
Zfp976	C	T	7: 42,613,930	S161N	probably benign	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R6738:Krt76	UTSW	15	101887478	missense	probably benign	0.40
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
R8079:Krt76	UTSW	15	101888390	missense	possibly damaging	0.61
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTCTCTGGATCATCCTG -3'
(R):5'- GCATCTCTGCTACTGGAGAAG -3'

Sequencing Primer
(F):5'- GGATCATCCTGTTGAGATCCATGATC -3'
(R):5'- AGAAGCCCTGGCATCATTTG -3'

Posted On

2014-10-01