Incidental Mutation 'R2160:Krt76'
ID 235132
Institutional Source Beutler Lab
Gene Symbol Krt76
Ensembl Gene ENSMUSG00000075402
Gene Name keratin 76
Synonyms 2310001L23Rik
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2160 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 101884351-101892920 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101888385 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 360 (Y360H)
Ref Sequence ENSEMBL: ENSMUSP00000097754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100179]
AlphaFold Q3UV17
Predicted Effect probably damaging
Transcript: ENSMUST00000100179
AA Change: Y360H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: Y360H

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 161 5.7e-39 PFAM
Filament 164 479 2.12e-166 SMART
low complexity region 488 551 N/A INTRINSIC
low complexity region 565 593 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196731
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Rab11fip3 G A 17: 26,069,054 H42Y probably benign Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Krt76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Krt76 APN 15 101884888 missense unknown
IGL01475:Krt76 APN 15 101888513 missense probably benign 0.11
IGL01504:Krt76 APN 15 101888173 missense probably damaging 1.00
IGL01506:Krt76 APN 15 101892400 missense probably damaging 0.97
IGL01943:Krt76 APN 15 101889045 missense probably null 0.98
IGL03164:Krt76 APN 15 101887451 missense possibly damaging 0.50
PIT4378001:Krt76 UTSW 15 101892407 missense probably damaging 0.99
R0105:Krt76 UTSW 15 101884912 missense unknown
R0105:Krt76 UTSW 15 101884912 missense unknown
R0448:Krt76 UTSW 15 101890647 missense probably damaging 1.00
R0730:Krt76 UTSW 15 101887349 missense probably damaging 1.00
R0920:Krt76 UTSW 15 101892439 missense possibly damaging 0.80
R1568:Krt76 UTSW 15 101885008 missense unknown
R1779:Krt76 UTSW 15 101892687 missense unknown
R1869:Krt76 UTSW 15 101889487 critical splice donor site probably null
R1911:Krt76 UTSW 15 101888165 nonsense probably null
R2504:Krt76 UTSW 15 101884858 missense unknown
R4487:Krt76 UTSW 15 101890482 missense possibly damaging 0.71
R4729:Krt76 UTSW 15 101889081 missense probably damaging 1.00
R4747:Krt76 UTSW 15 101885745 missense probably damaging 1.00
R4912:Krt76 UTSW 15 101888162 nonsense probably null
R5357:Krt76 UTSW 15 101887385 missense probably benign 0.04
R6738:Krt76 UTSW 15 101887478 missense probably benign 0.40
R7786:Krt76 UTSW 15 101890530 missense probably damaging 0.98
R7808:Krt76 UTSW 15 101890494 missense probably damaging 1.00
R7825:Krt76 UTSW 15 101887503 missense possibly damaging 0.46
R8079:Krt76 UTSW 15 101888390 missense possibly damaging 0.61
R8846:Krt76 UTSW 15 101887337 missense probably damaging 1.00
R8980:Krt76 UTSW 15 101892555 missense unknown
Z1088:Krt76 UTSW 15 101890551 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTCTGGATCATCCTG -3'
(R):5'- GCATCTCTGCTACTGGAGAAG -3'

Sequencing Primer
(F):5'- GGATCATCCTGTTGAGATCCATGATC -3'
(R):5'- AGAAGCCCTGGCATCATTTG -3'
Posted On 2014-10-01