Incidental Mutation 'R2160:Rab11fip3'
ID235133
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene NameRAB11 family interacting protein 3 (class II)
SynonymsD030060O14Rik, Rab11-FIP3
MMRRC Submission 040163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2160 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25989036-26069409 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26069054 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 42 (H42Y)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]
Predicted Effect probably benign
Transcript: ENSMUST00000120691
AA Change: H42Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: H42Y

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122103
AA Change: H42Y

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: H42Y

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126306
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bpifb9b A G 2: 154,319,675 N576D possibly damaging Het
Braf C T 6: 39,662,073 C248Y probably damaging Het
Carmil2 A G 8: 105,697,048 E1218G possibly damaging Het
Cntnap4 G T 8: 112,757,571 G419C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah9 C T 11: 66,117,483 D839N probably damaging Het
Evc2 A G 5: 37,380,518 T517A possibly damaging Het
Fbxw8 G A 5: 118,124,988 P209S probably damaging Het
Gcm1 A G 9: 78,061,380 K121E probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Herc2 A G 7: 56,212,922 D4077G probably benign Het
Inpp4b T A 8: 82,121,375 L937* probably null Het
Ipcef1 A T 10: 6,890,650 I349N probably damaging Het
Ipmk A G 10: 71,381,426 T267A probably benign Het
Jph3 G T 8: 121,753,231 R216L possibly damaging Het
Kctd16 A G 18: 40,259,085 E242G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt76 A G 15: 101,888,385 Y360H probably damaging Het
Lctl A G 9: 64,117,767 I12V probably benign Het
Lrig3 T C 10: 125,997,696 V347A possibly damaging Het
Lrrk2 C T 15: 91,796,060 S2058F probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mon2 T A 10: 123,075,929 K12* probably null Het
Nupl1 A G 14: 60,239,508 V238A probably benign Het
Pak7 T C 2: 136,098,382 D504G probably benign Het
Pla2g4e T C 2: 120,185,206 S286G probably benign Het
Ppfia4 A T 1: 134,313,723 V498D probably benign Het
Ppfibp1 A G 6: 147,027,453 E846G probably damaging Het
Ppp3ca G A 3: 136,877,630 C166Y probably damaging Het
Prpf3 T C 3: 95,845,230 K244E probably benign Het
Pzp A G 6: 128,525,276 S37P probably damaging Het
Sprn C A 7: 140,153,506 probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Thap12 A G 7: 98,710,126 S71G probably damaging Het
Vmn1r7 A G 6: 57,024,894 F127S probably damaging Het
Vmn2r54 C T 7: 12,615,493 V721I probably benign Het
Vmn2r56 A G 7: 12,694,219 F707L probably benign Het
Zfp976 C T 7: 42,613,930 S161N probably benign Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 25991809 splice site probably benign
IGL00420:Rab11fip3 APN 17 26067625 missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26016113 missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26068735 missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26067982 missense probably damaging 0.97
IGL01764:Rab11fip3 APN 17 26068693 missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26068003 missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26067892 missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26068835 missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 25994320 missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26067679 missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26016113 missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 25990999 missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26069072 missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 25994225 missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26068847 missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26004554 missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 25991322 missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26068891 missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26024391 missense probably damaging 0.97
R2197:Rab11fip3 UTSW 17 26068178 missense probably benign
R2382:Rab11fip3 UTSW 17 25990867 nonsense probably null
R3028:Rab11fip3 UTSW 17 26015942 critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26068526 missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26068028 frame shift probably null
R4064:Rab11fip3 UTSW 17 26024394 missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26016083 missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26036657 missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26068706 missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26067580 critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 25991026 missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26068078 missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 25992581 critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26016143 missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 25991295 missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26016064 missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26036664 missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26016116 missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26067869 missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 25991057 missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 25991718 missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26069090 missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26068152 missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26068874 missense possibly damaging 0.66
R7836:Rab11fip3 UTSW 17 26068258 missense possibly damaging 0.82
R7919:Rab11fip3 UTSW 17 26068258 missense possibly damaging 0.82
R8008:Rab11fip3 UTSW 17 26067982 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAACTCCTTGGCCAAGTG -3'
(R):5'- TACATCATCCGGACTGTGCC -3'

Sequencing Primer
(F):5'- CAAGTGGCACGGTGTGTC -3'
(R):5'- ACTGTGCCGCTGCCATG -3'
Posted On2014-10-01