Mutagenetix > Incidental Mutations

Incidental Mutation 'R2161:Ndufa8'

235141

Institutional Source

Beutler Lab

Gene Symbol

Ndufa8

Ensembl Gene

ENSMUSG00000026895

Gene Name

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8

Synonyms

0610033L03Rik

MMRRC Submission

040164-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2161 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36036326-36049406 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36036515 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 170 (W170R)

Ref Sequence

ENSEMBL: ENSMUSP00000065352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070112]

Predicted Effect

probably damaging
Transcript: ENSMUST00000070112
AA Change: W170R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000065352
Gene: ENSMUSG00000026895
AA Change: W170R

Domain	Start	End	E-Value	Type
low complexity region	5	29	N/A	INTRINSIC
Pfam:CHCH	78	113	3.6e-10	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 19 kDa subunit family. Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays an important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	T	C	8: 36,505,650	C85R	probably damaging	Het
Adamts12	A	G	15: 11,215,735	M281V	probably damaging	Het
Ap1g1	A	T	8: 109,844,354	D423V	probably damaging	Het
Arel1	A	G	12: 84,921,256		probably null	Het
Arhgap33	T	C	7: 30,528,650		probably null	Het
Arhgef18	T	G	8: 3,439,575	Y302*	probably null	Het
Blm	T	C	7: 80,481,370		probably null	Het
Cep295	T	G	9: 15,353,058	E97D	probably damaging	Het
Cep295nl	T	C	11: 118,332,509	D503G	possibly damaging	Het
Chchd2	G	T	5: 129,884,148	A29E	probably damaging	Het
Cic	A	G	7: 25,288,134		probably null	Het
Cmtr1	C	T	17: 29,702,173	L798F	probably benign	Het
Col11a2	C	A	17: 34,064,797		probably benign	Het
Crispld2	A	G	8: 120,015,339	Y142C	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Dsp	G	A	13: 38,196,451	D1792N	probably damaging	Het
Esp4	C	A	17: 40,602,393	N50K	probably benign	Het
Fbxo21	T	C	5: 117,995,386	S404P	probably damaging	Het
Ggnbp2	A	G	11: 84,834,433	F639L	probably benign	Het
Golph3l	G	A	3: 95,617,125	G229D	probably damaging	Het
Hlx	G	T	1: 184,727,641	S433R	probably benign	Het
Kdm2b	T	A	5: 122,880,699	S233C	probably damaging	Het
Krt14	C	T	11: 100,207,113	G115R	unknown	Het
Ldb3	A	G	14: 34,567,396		probably null	Het
Lrp1	T	A	10: 127,555,738	E2937D	probably damaging	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Naa20	T	A	2: 145,911,795		probably null	Het
Nlrp2	A	T	7: 5,325,042	L671I	probably damaging	Het
Olfr1462	T	A	19: 13,191,309	I214K	probably damaging	Het
Olfr603	T	A	7: 103,383,200	R267S	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Ptpro	A	G	6: 137,449,887	D280G	probably benign	Het
Reps1	A	G	10: 18,096,283	E361G	probably damaging	Het
Rgs6	A	G	12: 83,091,804	E304G	probably damaging	Het
Siglece	T	C	7: 43,659,369	T187A	probably benign	Het
Slc5a10	C	T	11: 61,719,934	G5R	probably null	Het
Sohlh1	A	G	2: 25,844,636	I215T	probably benign	Het
Stag1	T	A	9: 100,889,595	V691D	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Tmed8	A	G	12: 87,174,257	V185A	probably damaging	Het
Trim71	A	G	9: 114,512,772	F814S	probably damaging	Het
Tsnax	A	T	8: 125,015,689	K52N	probably damaging	Het
Tubgcp3	T	C	8: 12,632,292	T676A	probably benign	Het

Other mutations in Ndufa8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Ndufa8	APN	2	36044455	missense	probably damaging	0.99
IGL02603:Ndufa8	APN	2	36044458	missense	probably damaging	1.00
R0322:Ndufa8	UTSW	2	36036622	missense	probably benign	0.11
R2287:Ndufa8	UTSW	2	36036542	missense	probably benign	0.36
R3001:Ndufa8	UTSW	2	36036559	missense	possibly damaging	0.83
R3002:Ndufa8	UTSW	2	36036559	missense	possibly damaging	0.83
R6186:Ndufa8	UTSW	2	36039740	missense	probably benign	0.16
R7068:Ndufa8	UTSW	2	36044435	missense	possibly damaging	0.95
R8536:Ndufa8	UTSW	2	36049300	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGGGAAGTCATCTTTAAAGGC -3'
(R):5'- CAAGAGTCTCTTTGAACCCTGAC -3'

Sequencing Primer
(F):5'- GGAAGTCATCTTTAAAGGCTAAAAGG -3'
(R):5'- GAACCCTGACTCTCTTCTTCG -3'

Posted On

2014-10-01