Incidental Mutation 'R0197:Smpd4'
ID23515
Institutional Source Beutler Lab
Gene Symbol Smpd4
Ensembl Gene ENSMUSG00000005899
Gene Namesphingomyelin phosphodiesterase 4
Synonyms4122402O22Rik, neutral membrane (neutral sphingomyelinase-3)
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R0197 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17619354-17644828 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 17641597 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006053] [ENSMUST00000056962] [ENSMUST00000090159] [ENSMUST00000163476] [ENSMUST00000163997] [ENSMUST00000165363] [ENSMUST00000170117] [ENSMUST00000170273] [ENSMUST00000170366] [ENSMUST00000170996] [ENSMUST00000182117] [ENSMUST00000182368] [ENSMUST00000231436] [ENSMUST00000231627] [ENSMUST00000231722] [ENSMUST00000231792] [ENSMUST00000232021] [ENSMUST00000232116] [ENSMUST00000232271]
Predicted Effect probably null
Transcript: ENSMUST00000006053
SMART Domains Protein: ENSMUSP00000006053
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 768 N/A PFAM
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056962
SMART Domains Protein: ENSMUSP00000049541
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 50 105 4.1e-24 PFAM
low complexity region 154 164 N/A INTRINSIC
Pfam:CCDC74_C 209 326 1.4e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000090159
SMART Domains Protein: ENSMUSP00000087620
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.4e-177 PFAM
Pfam:mit_SMPDase 287 752 9.4e-259 PFAM
transmembrane domain 753 775 N/A INTRINSIC
transmembrane domain 782 799 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163476
SMART Domains Protein: ENSMUSP00000131867
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 739 9.8e-266 PFAM
transmembrane domain 740 762 N/A INTRINSIC
transmembrane domain 769 786 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163997
SMART Domains Protein: ENSMUSP00000128595
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.1e-17 PFAM
Pfam:mit_SMPDase 42 68 2.5e-13 PFAM
Pfam:mit_SMPDase 65 518 4.9e-266 PFAM
transmembrane domain 519 541 N/A INTRINSIC
transmembrane domain 548 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164292
Predicted Effect probably null
Transcript: ENSMUST00000165363
SMART Domains Protein: ENSMUSP00000130720
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 289 6.2e-177 PFAM
Pfam:mit_SMPDase 285 738 4.1e-262 PFAM
transmembrane domain 739 761 N/A INTRINSIC
transmembrane domain 768 785 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167592
Predicted Effect
SMART Domains Protein: ENSMUSP00000132279
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 46 2.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170273
SMART Domains Protein: ENSMUSP00000129957
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 43 2.6e-17 PFAM
Pfam:mit_SMPDase 41 215 4.1e-103 PFAM
Pfam:mit_SMPDase 214 666 1.3e-265 PFAM
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170366
SMART Domains Protein: ENSMUSP00000130990
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 8 288 7.1e-177 PFAM
Pfam:mit_SMPDase 286 643 1.8e-214 PFAM
Pfam:mit_SMPDase 642 696 8.6e-18 PFAM
transmembrane domain 697 719 N/A INTRINSIC
transmembrane domain 726 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170401
Predicted Effect probably null
Transcript: ENSMUST00000170996
SMART Domains Protein: ENSMUSP00000129074
Gene: ENSMUSG00000005899

DomainStartEndE-ValueType
Pfam:mit_SMPDase 26 444 4.4e-234 PFAM
transmembrane domain 445 467 N/A INTRINSIC
transmembrane domain 474 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182117
SMART Domains Protein: ENSMUSP00000138657
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Pfam:CCDC92 36 97 2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182368
SMART Domains Protein: ENSMUSP00000138262
Gene: ENSMUSG00000041617

DomainStartEndE-ValueType
low complexity region 12 34 N/A INTRINSIC
Pfam:CCDC92 49 110 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182822
Predicted Effect probably benign
Transcript: ENSMUST00000182976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231378
Predicted Effect probably null
Transcript: ENSMUST00000231436
Predicted Effect probably benign
Transcript: ENSMUST00000231627
Predicted Effect probably benign
Transcript: ENSMUST00000231722
Predicted Effect probably null
Transcript: ENSMUST00000231792
Predicted Effect probably null
Transcript: ENSMUST00000232021
Predicted Effect probably benign
Transcript: ENSMUST00000232116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232270
Predicted Effect probably null
Transcript: ENSMUST00000232271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232468
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingomyelinases (EC 3.1.4.12), such as SMPD4, catalyze the hydrolysis of membrane sphingomyelin to form phosphorylcholine and ceramide (Krut et al., 2006 [PubMed 16517606]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Smpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Smpd4 APN 16 17642757 missense probably benign 0.04
IGL01461:Smpd4 APN 16 17621506 missense probably damaging 1.00
IGL02051:Smpd4 APN 16 17626518 missense probably damaging 1.00
IGL02492:Smpd4 APN 16 17639351 missense probably damaging 1.00
IGL03181:Smpd4 APN 16 17625807 nonsense probably null
Victim UTSW 16 17640971 missense probably damaging 1.00
weakling UTSW 16 17638486 intron probably benign
R0549:Smpd4 UTSW 16 17639312 missense probably benign 0.15
R0789:Smpd4 UTSW 16 17625826 missense probably benign 0.14
R1077:Smpd4 UTSW 16 17623969 missense probably damaging 1.00
R1120:Smpd4 UTSW 16 17638486 intron probably benign
R1716:Smpd4 UTSW 16 17642501 missense probably damaging 1.00
R1758:Smpd4 UTSW 16 17626008 missense probably damaging 0.99
R1758:Smpd4 UTSW 16 17640880 missense probably damaging 1.00
R1838:Smpd4 UTSW 16 17642302 splice site probably null
R2115:Smpd4 UTSW 16 17626865 missense probably benign 0.33
R2849:Smpd4 UTSW 16 17642212 missense probably damaging 1.00
R4654:Smpd4 UTSW 16 17642128 intron probably benign
R6157:Smpd4 UTSW 16 17641066 splice site probably null
R6190:Smpd4 UTSW 16 17632013 missense probably damaging 1.00
R6822:Smpd4 UTSW 16 17640233 missense probably damaging 1.00
R7062:Smpd4 UTSW 16 17640971 missense probably damaging 1.00
R7305:Smpd4 UTSW 16 17641783 missense probably damaging 0.99
R7759:Smpd4 UTSW 16 17638633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCAGCTCATCACACAGGC -3'
(R):5'- TGAGAAACGACAGCTCATGCGAC -3'

Sequencing Primer
(F):5'- AGACTGCCAAGTCCATCTCTG -3'
(R):5'- CAATGCAATCTGGGAGCTGC -3'
Posted On2013-04-16