Mutagenetix > Incidental Mutations

Incidental Mutation 'R0197:Chd1'

23517

Institutional Source

Beutler Lab

Gene Symbol

Chd1

Ensembl Gene

ENSMUSG00000023852

Gene Name

chromodomain helicase DNA binding protein 1

Synonyms

4930525N21Rik

MMRRC Submission

038456-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0197 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

15704967-15772610 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 15725431 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 72 (N72K)

Ref Sequence

ENSEMBL: ENSMUSP00000134091 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]

Predicted Effect

probably benign
Transcript: ENSMUST00000024627
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N72K

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1234	1e-112	BLAST
PDB:4B4C\|A	1119	1320	1e-132	PDB
low complexity region	1325	1348	N/A	INTRINSIC
low complexity region	1377	1388	N/A	INTRINSIC
DUF4208	1396	1500	5.54e-51	SMART
low complexity region	1507	1516	N/A	INTRINSIC
low complexity region	1538	1549	N/A	INTRINSIC
low complexity region	1626	1650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173159

Predicted Effect

probably benign
Transcript: ENSMUST00000173311
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: N72K

Domain	Start	End	E-Value	Type
low complexity region	17	67	N/A	INTRINSIC
low complexity region	105	115	N/A	INTRINSIC
low complexity region	116	136	N/A	INTRINSIC
low complexity region	151	175	N/A	INTRINSIC
low complexity region	213	230	N/A	INTRINSIC
CHROMO	268	355	6.43e-20	SMART
CHROMO	385	443	1.19e-14	SMART
DEXDc	475	672	3.44e-34	SMART
Blast:DEXDc	692	786	2e-54	BLAST
low complexity region	787	799	N/A	INTRINSIC
HELICc	816	900	8.48e-25	SMART
Blast:DEXDc	955	1078	2e-38	BLAST

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 92.5%
20x: 75.9%

Validation Efficiency

97% (121/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
2610507B11Rik	A	C	11: 78,269,704		probably benign	Het
4930452B06Rik	C	T	14: 8,518,695	G254R	probably damaging	Het
Abcc2	A	T	19: 43,826,614	R1147*	probably null	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Aldh9a1	A	G	1: 167,361,847	D388G	probably damaging	Het
Ap3d1	G	T	10: 80,730,042	A97E	probably damaging	Het
Arhgef10	T	A	8: 14,962,636	V320E	probably damaging	Het
Baiap2l1	C	A	5: 144,266,010	V498L	probably damaging	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Col4a3bp	T	A	13: 96,549,287	Y63N	probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Dlx5	T	C	6: 6,881,619	K90E	possibly damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Espnl	T	G	1: 91,344,489	Y524D	probably damaging	Het
Fam20c	T	C	5: 138,755,724	L30P	probably damaging	Het
Fat1	G	T	8: 45,026,553	A2879S	probably benign	Het
Gabrg1	A	T	5: 70,774,389	V337D	probably damaging	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gcc1	T	C	6: 28,420,616	H234R	probably damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Glt6d1	A	G	2: 25,794,070	I308T	probably benign	Het
Gm10320	T	C	13: 98,491,983	T7A	probably benign	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm13088	C	T	4: 143,656,440	E70K	possibly damaging	Het
Gmpr2	T	A	14: 55,672,735	D7E	possibly damaging	Het
Hc	A	G	2: 34,984,750	Y1620H	probably damaging	Het
Hoxa3	T	C	6: 52,170,143		probably benign	Het
Ift140	A	G	17: 25,090,933	T1105A	probably benign	Het
Kdr	G	T	5: 75,968,422	T188N	possibly damaging	Het
Lepr	A	T	4: 101,752,152	D312V	possibly damaging	Het
Mcm3	A	G	1: 20,810,105	V501A	probably damaging	Het
Mcur1	T	C	13: 43,545,740	Y267C	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mroh2a	G	C	1: 88,246,042	A871P	probably damaging	Het
Ndrg2	T	A	14: 51,907,003		probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Onecut2	T	A	18: 64,341,472	S365T	possibly damaging	Het
Pds5b	C	A	5: 150,754,431	Q505K	probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Samd3	T	A	10: 26,271,854	C476S	possibly damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Smpd4	T	A	16: 17,641,597		probably null	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Svep1	T	C	4: 58,070,851	K2312E	possibly damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Usp24	T	A	4: 106,407,133	W1754R	probably damaging	Het
Utp20	G	A	10: 88,777,516	P1301L	probably benign	Het
Vmn2r115	T	A	17: 23,359,781	S743T	probably damaging	Het
Vps41	T	G	13: 18,854,663		probably null	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Chd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Chd1	APN	17	15732565	missense	probably benign	0.37
IGL01356:Chd1	APN	17	15749865	missense	probably damaging	1.00
IGL01369:Chd1	APN	17	15754997	missense	probably damaging	0.97
IGL01519:Chd1	APN	17	17378569	missense	probably damaging	1.00
IGL01604:Chd1	APN	17	15770097	missense	possibly damaging	0.95
IGL01635:Chd1	APN	17	17378596	missense	probably damaging	1.00
IGL01721:Chd1	APN	17	15770168	missense	probably damaging	1.00
IGL01959:Chd1	APN	17	15742173	missense	probably damaging	1.00
IGL02367:Chd1	APN	17	17390053	missense	probably damaging	0.98
IGL02476:Chd1	APN	17	15734273	missense	probably damaging	1.00
IGL02756:Chd1	APN	17	15730807	missense	probably damaging	0.97
IGL02817:Chd1	APN	17	15749500	missense	possibly damaging	0.92
IGL03084:Chd1	APN	17	15770298	missense	probably benign	0.22
IGL03108:Chd1	APN	17	15725281	missense	possibly damaging	0.70
Holly	UTSW	17	15726283	missense	possibly damaging	0.72
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0053:Chd1	UTSW	17	15747189	missense	probably damaging	1.00
R0128:Chd1	UTSW	17	17393567	missense	probably damaging	1.00
R0285:Chd1	UTSW	17	17374680	splice site	probably benign
R0326:Chd1	UTSW	17	15768566	missense	probably damaging	1.00
R0326:Chd1	UTSW	17	15768568	missense	probably benign
R0372:Chd1	UTSW	17	17387290	missense	probably benign	0.14
R0391:Chd1	UTSW	17	15749894	missense	probably damaging	1.00
R0486:Chd1	UTSW	17	15734342	missense	probably damaging	0.99
R0637:Chd1	UTSW	17	15742288	missense	possibly damaging	0.50
R0675:Chd1	UTSW	17	15758261	unclassified	probably benign
R0701:Chd1	UTSW	17	15725431	missense	probably benign
R0788:Chd1	UTSW	17	15707114	missense	possibly damaging	0.86
R0848:Chd1	UTSW	17	15770241	missense	probably damaging	1.00
R0883:Chd1	UTSW	17	15725431	missense	probably benign
R1169:Chd1	UTSW	17	15735732	missense	probably damaging	1.00
R1218:Chd1	UTSW	17	15725312	missense	probably damaging	1.00
R1370:Chd1	UTSW	17	17387480	missense	probably benign	0.00
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1470:Chd1	UTSW	17	15726283	missense	possibly damaging	0.72
R1478:Chd1	UTSW	17	15739507	missense	probably damaging	0.99
R1752:Chd1	UTSW	17	15743232	critical splice donor site	probably null
R1759:Chd1	UTSW	17	17387271	missense	probably benign	0.00
R1767:Chd1	UTSW	17	15770303	missense	probably damaging	1.00
R1938:Chd1	UTSW	17	15762486	missense	probably benign	0.39
R2007:Chd1	UTSW	17	15731006	missense	probably damaging	1.00
R2069:Chd1	UTSW	17	15742294	missense	probably damaging	1.00
R3771:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3773:Chd1	UTSW	17	17374651	missense	probably damaging	1.00
R3849:Chd1	UTSW	17	15731871	missense	probably damaging	1.00
R4241:Chd1	UTSW	17	15770027	nonsense	probably null
R4242:Chd1	UTSW	17	15770027	nonsense	probably null
R4354:Chd1	UTSW	17	17390001	missense	probably benign	0.23
R4468:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4469:Chd1	UTSW	17	15760395	missense	probably damaging	0.99
R4731:Chd1	UTSW	17	17377817	missense	probably benign	0.36
R4824:Chd1	UTSW	17	15733124	missense	probably damaging	1.00
R4840:Chd1	UTSW	17	15768753	nonsense	probably null
R4840:Chd1	UTSW	17	15768754	missense	probably damaging	1.00
R4880:Chd1	UTSW	17	17374654	missense	probably damaging	1.00
R4960:Chd1	UTSW	17	15742231	missense	probably damaging	0.96
R5071:Chd1	UTSW	17	15762405	missense	probably benign
R5078:Chd1	UTSW	17	15726354	missense	possibly damaging	0.93
R5114:Chd1	UTSW	17	15728198	missense	probably benign	0.25
R5268:Chd1	UTSW	17	15735743	missense	probably damaging	1.00
R5304:Chd1	UTSW	17	15754951	missense	probably benign	0.01
R5304:Chd1	UTSW	17	15770268	missense	possibly damaging	0.55
R5307:Chd1	UTSW	17	15732570	missense	probably damaging	1.00
R5458:Chd1	UTSW	17	15738549	missense	probably damaging	1.00
R5553:Chd1	UTSW	17	17385613	missense	probably benign	0.17
R5623:Chd1	UTSW	17	15754932	missense	probably damaging	1.00
R6022:Chd1	UTSW	17	17377773	missense	probably benign	0.39
R6137:Chd1	UTSW	17	15758688	missense	probably damaging	1.00
R6257:Chd1	UTSW	17	15730203	splice site	probably null
R6373:Chd1	UTSW	17	15738636	missense	probably damaging	1.00
R6458:Chd1	UTSW	17	15730602	missense	probably benign	0.01
R6476:Chd1	UTSW	17	17380988	critical splice donor site	probably null
R6508:Chd1	UTSW	17	15738633	missense	probably benign	0.31
R6553:Chd1	UTSW	17	15725430	missense	probably benign	0.00
R6745:Chd1	UTSW	17	17387167	missense	probably benign	0.08
R7107:Chd1	UTSW	17	15761366	missense	probably damaging	0.98
R7230:Chd1	UTSW	17	15706937	splice site	probably null
R7317:Chd1	UTSW	17	15742274	missense	possibly damaging	0.71
R7341:Chd1	UTSW	17	15770237	missense	probably damaging	0.99
R7421:Chd1	UTSW	17	15749398	missense	probably benign	0.03
R7704:Chd1	UTSW	17	15767475	missense	probably benign
R7763:Chd1	UTSW	17	15733041	missense	probably damaging	1.00
R8156:Chd1	UTSW	17	15761404	missense	probably benign
R8194:Chd1	UTSW	17	17374475	start gained	probably benign
R8261:Chd1	UTSW	17	17387542	missense	probably benign	0.02
R8338:Chd1	UTSW	17	15769980	missense	probably damaging	1.00
R8401:Chd1	UTSW	17	15743211	missense	probably damaging	1.00
R8411:Chd1	UTSW	17	15762449	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15766347	missense	probably damaging	0.98
Z1176:Chd1	UTSW	17	15768733	missense	probably damaging	1.00
Z1177:Chd1	UTSW	17	15747801	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTGTGGGTCAGCATCAGGC -3'
(R):5'- CCTTGGGCAGATAGACAGACAAGC -3'

Sequencing Primer
(F):5'- GCTCTGACTCAGGAAGTCAATCA -3'
(R):5'- CAACCACTTGGTGCTTGTG -3'

Posted On

2013-04-16