Incidental Mutation 'R0197:Ift140'
ID 23518
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0197 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 25016091-25099495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25090933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1105 (T1105A)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: T1105A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: T1105A

WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: T1105A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: T1105A

WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153895
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fam20c T C 5: 138,755,724 L30P probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
R8747:Ift140 UTSW 17 25035835 missense probably benign
R8932:Ift140 UTSW 17 25086888 missense probably benign 0.03
R9226:Ift140 UTSW 17 25098865 missense probably benign 0.00
R9347:Ift140 UTSW 17 25094779 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctcaaactcagaaatccgcc -3'
Posted On 2013-04-16