Mutagenetix > Incidental Mutations

Incidental Mutation 'R0197:Ift140'

23518

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

038456-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0197 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25090933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1105 (T1105A)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: T1105A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: T1105A

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: T1105A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: T1105A

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139300

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140692

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Meta Mutation Damage Score

0.1103

Coding Region Coverage

1x: 98.6%
3x: 97.3%
10x: 92.5%
20x: 75.9%

Validation Efficiency

97% (121/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 138,069,871	L1607P	probably damaging	Het
1700016H13Rik	T	C	5: 103,648,821	*118W	probably null	Het
1700061G19Rik	A	T	17: 56,883,835	N468Y	probably benign	Het
2610507B11Rik	A	C	11: 78,269,704		probably benign	Het
4930452B06Rik	C	T	14: 8,518,695	G254R	probably damaging	Het
Abcc2	A	T	19: 43,826,614	R1147*	probably null	Het
Agap2	A	G	10: 127,091,702	T1131A	possibly damaging	Het
Aldh9a1	A	G	1: 167,361,847	D388G	probably damaging	Het
Ap3d1	G	T	10: 80,730,042	A97E	probably damaging	Het
Arhgef10	T	A	8: 14,962,636	V320E	probably damaging	Het
Baiap2l1	C	A	5: 144,266,010	V498L	probably damaging	Het
Ccdc189	T	C	7: 127,584,862	E261G	probably damaging	Het
Cdh2	T	C	18: 16,629,576	N437S	probably benign	Het
Chd1	C	A	17: 15,725,431	N72K	probably benign	Het
Col4a3bp	T	A	13: 96,549,287	Y63N	probably benign	Het
Cstf2t	A	T	19: 31,084,626	M521L	probably benign	Het
Dlx5	T	C	6: 6,881,619	K90E	possibly damaging	Het
Dmp1	A	G	5: 104,207,630	E32G	possibly damaging	Het
Espnl	T	G	1: 91,344,489	Y524D	probably damaging	Het
Fam20c	T	C	5: 138,755,724	L30P	probably damaging	Het
Fat1	G	T	8: 45,026,553	A2879S	probably benign	Het
Gabrg1	A	T	5: 70,774,389	V337D	probably damaging	Het
Gart	C	A	16: 91,623,403	D851Y	possibly damaging	Het
Gcc1	T	C	6: 28,420,616	H234R	probably damaging	Het
Gemin6	T	A	17: 80,228,095	H161Q	probably damaging	Het
Glt6d1	A	G	2: 25,794,070	I308T	probably benign	Het
Gm10320	T	C	13: 98,491,983	T7A	probably benign	Het
Gm10912	T	C	2: 104,066,530	S5P	probably benign	Het
Gm13088	C	T	4: 143,656,440	E70K	possibly damaging	Het
Gmpr2	T	A	14: 55,672,735	D7E	possibly damaging	Het
Hc	A	G	2: 34,984,750	Y1620H	probably damaging	Het
Hoxa3	T	C	6: 52,170,143		probably benign	Het
Kdr	G	T	5: 75,968,422	T188N	possibly damaging	Het
Lepr	A	T	4: 101,752,152	D312V	possibly damaging	Het
Mcm3	A	G	1: 20,810,105	V501A	probably damaging	Het
Mcur1	T	C	13: 43,545,740	Y267C	probably damaging	Het
Med13	T	A	11: 86,307,038	T736S	probably benign	Het
Med13l	T	C	5: 118,671,002		probably benign	Het
Mroh2a	G	C	1: 88,246,042	A871P	probably damaging	Het
Ndrg2	T	A	14: 51,907,003		probably benign	Het
Oas3	G	A	5: 120,756,145	R39C	probably damaging	Het
Olfr1258	A	G	2: 89,930,201	T131A	probably benign	Het
Olfr1298	C	T	2: 111,645,791	V69I	probably benign	Het
Olfr272	G	A	4: 52,910,849	T315M	probably benign	Het
Olfr558	T	A	7: 102,709,995	H245Q	probably damaging	Het
Onecut2	T	A	18: 64,341,472	S365T	possibly damaging	Het
Pds5b	C	A	5: 150,754,431	Q505K	probably benign	Het
Rfx2	T	C	17: 56,803,722	Y88C	probably damaging	Het
Rpl6	T	C	5: 121,208,478	V214A	probably benign	Het
Samd3	T	A	10: 26,271,854	C476S	possibly damaging	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shank1	C	T	7: 44,352,294	R1146W	unknown	Het
Smcr8	T	C	11: 60,778,115	Y30H	probably damaging	Het
Smpd4	T	A	16: 17,641,597		probably null	Het
Strip1	C	A	3: 107,614,613	D750Y	probably damaging	Het
Svep1	T	C	4: 58,070,851	K2312E	possibly damaging	Het
Taf1c	A	T	8: 119,599,983	I438N	probably damaging	Het
Tnfaip1	A	T	11: 78,530,014		probably benign	Het
Unc45b	T	A	11: 82,940,205	L797Q	possibly damaging	Het
Usp24	T	A	4: 106,407,133	W1754R	probably damaging	Het
Utp20	G	A	10: 88,777,516	P1301L	probably benign	Het
Vmn2r115	T	A	17: 23,359,781	S743T	probably damaging	Het
Vps41	T	G	13: 18,854,663		probably null	Het
Vps72	G	T	3: 95,122,583	L304F	probably damaging	Het
Wiz	A	T	17: 32,356,441	I907N	probably damaging	Het
Zfp521	T	C	18: 13,845,062	T765A	probably benign	Het
Zfp616	A	T	11: 74,085,674	H923L	probably damaging	Het
Zp2	A	T	7: 120,143,576		probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTCATGCTGTACCACAAGGTGAGTG -3'
(R):5'- TGACTTCCAGCCCAAGTTGTAGCC -3'

Sequencing Primer
(F):5'- AAGGTGAGTGCATGGCCTC -3'
(R):5'- ctcaaactcagaaatccgcc -3'

Posted On

2013-04-16