Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Ttll4'

235184

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

040165-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R2162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74686391 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 653 (K653E)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000042125
AA Change: K653E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: K653E

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113678
AA Change: K653E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: K653E

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140591

Predicted Effect

probably benign
Transcript: ENSMUST00000141119

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145132

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155753

Meta Mutation Damage Score

0.8464

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- GTTCTGGTCTTGATCCTAAGGC -3'
(R):5'- AACAGACAGTGCCTCTCAAG -3'

Sequencing Primer
(F):5'- ATCCTAAGGCCTCATGTAGGG -3'
(R):5'- AGTGCCTCTCAAGAAATGGC -3'

Posted On

2014-10-01