Incidental Mutation 'R2162:Olfr1145'
ID235189
Institutional Source Beutler Lab
Gene Symbol Olfr1145
Ensembl Gene ENSMUSG00000068814
Gene Nameolfactory receptor 1145
SynonymsGA_x6K02T2Q125-49311440-49312384, MOR264-19
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87809822-87810799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87810360 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 180 (I180K)
Ref Sequence ENSEMBL: ENSMUSP00000088209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000090707]
Predicted Effect probably damaging
Transcript: ENSMUST00000079711
AA Change: I169K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: I169K

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090707
AA Change: I180K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088209
Gene: ENSMUSG00000068814
AA Change: I180K

DomainStartEndE-ValueType
transmembrane domain 21 38 N/A INTRINSIC
Pfam:7tm_4 48 325 6.2e-58 PFAM
Pfam:7tm_1 58 307 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118227
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Olfr1145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Olfr1145 APN 2 87810648 missense probably damaging 1.00
IGL01335:Olfr1145 APN 2 87810446 missense probably damaging 1.00
PIT4418001:Olfr1145 UTSW 2 87810594 missense probably damaging 0.99
R1512:Olfr1145 UTSW 2 87810644 missense probably benign 0.23
R1700:Olfr1145 UTSW 2 87810768 missense probably benign
R2127:Olfr1145 UTSW 2 87810341 missense probably benign 0.09
R3707:Olfr1145 UTSW 2 87810176 missense probably damaging 1.00
R4327:Olfr1145 UTSW 2 87810152 missense probably benign 0.00
R4422:Olfr1145 UTSW 2 87810645 missense probably damaging 0.97
R4854:Olfr1145 UTSW 2 87810590 missense probably damaging 1.00
R5234:Olfr1145 UTSW 2 87810768 missense probably benign
R5858:Olfr1145 UTSW 2 87810641 missense probably benign 0.22
R6229:Olfr1145 UTSW 2 87810087 missense probably damaging 1.00
R6991:Olfr1145 UTSW 2 87810443 missense possibly damaging 0.76
R7007:Olfr1145 UTSW 2 87809886 missense probably damaging 1.00
R7027:Olfr1145 UTSW 2 87810716 missense possibly damaging 0.90
R7260:Olfr1145 UTSW 2 87810387 missense probably damaging 0.98
R7624:Olfr1145 UTSW 2 87810339 missense probably damaging 1.00
R7794:Olfr1145 UTSW 2 87810474 missense probably damaging 0.97
R8029:Olfr1145 UTSW 2 87810032 missense probably benign 0.00
Z1088:Olfr1145 UTSW 2 87810746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGGGAACTGATGAATGTTTCC -3'
(R):5'- AACAAGTGGAGAAGGCTTTTGC -3'

Sequencing Primer
(F):5'- AACTGATGAATGTTTCCTTCTGGC -3'
(R):5'- GCTGTTGGCAACCTCAAGATG -3'
Posted On2014-10-01