Incidental Mutation 'R2162:Mroh7'
ID235195
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Namemaestro heat-like repeat family member 7
SynonymsHeatr8, LOC381538, Gm1027
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106680417-106730925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 106700181 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 777 (S777R)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106770]
Predicted Effect probably damaging
Transcript: ENSMUST00000106770
AA Change: S777R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: S777R

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Meta Mutation Damage Score 0.2351 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106703161 missense probably benign 0.00
IGL01729:Mroh7 APN 4 106704205 missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106680874 missense probably benign 0.00
IGL02003:Mroh7 APN 4 106702529 missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106702510 missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106707782 missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106720591 missense probably benign 0.04
IGL02896:Mroh7 APN 4 106699816 missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106692398 missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106714091 nonsense probably null
holy UTSW 4 106709955 splice site probably null
moley UTSW 4 106694312 splice site probably null
P0016:Mroh7 UTSW 4 106707857 critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106721426 missense probably benign 0.07
R0094:Mroh7 UTSW 4 106703184 missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106711270 missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106691664 missense probably benign 0.01
R0828:Mroh7 UTSW 4 106699876 missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106680793 missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106707594 unclassified probably null
R1301:Mroh7 UTSW 4 106720495 missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106695141 splice site probably benign
R1491:Mroh7 UTSW 4 106703058 missense probably benign 0.11
R1540:Mroh7 UTSW 4 106703076 missense probably benign 0.11
R1560:Mroh7 UTSW 4 106711254 missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106720668 missense probably benign 0.19
R1804:Mroh7 UTSW 4 106694392 missense possibly damaging 0.76
R2265:Mroh7 UTSW 4 106720927 missense probably benign 0.01
R2866:Mroh7 UTSW 4 106691090 missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R3718:Mroh7 UTSW 4 106704210 missense probably benign 0.25
R4530:Mroh7 UTSW 4 106720437 missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106691513 critical splice donor site probably null
R4706:Mroh7 UTSW 4 106691624 missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106709955 splice site probably null
R4965:Mroh7 UTSW 4 106690987 missense possibly damaging 0.77
R4969:Mroh7 UTSW 4 106680873 missense probably benign
R4971:Mroh7 UTSW 4 106691552 missense probably benign 0.04
R5083:Mroh7 UTSW 4 106690318 missense probably benign 0.03
R5207:Mroh7 UTSW 4 106721386 missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106691643 missense probably benign 0.10
R5392:Mroh7 UTSW 4 106711251 critical splice donor site probably null
R5630:Mroh7 UTSW 4 106720567 missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106702618 missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106708560 missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106681885 missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106694312 splice site probably null
R5979:Mroh7 UTSW 4 106720926 missense probably benign 0.00
R6479:Mroh7 UTSW 4 106703188 missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106721263 missense probably benign 0.00
R6657:Mroh7 UTSW 4 106702500 nonsense probably null
R6732:Mroh7 UTSW 4 106680713 frame shift probably null
R6817:Mroh7 UTSW 4 106714115 missense probably benign 0.00
R6980:Mroh7 UTSW 4 106700237 missense probably benign 0.05
R7062:Mroh7 UTSW 4 106683980 missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106711320 missense probably benign 0.07
R7134:Mroh7 UTSW 4 106720594 missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106691639 missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106683918 missense probably benign
R7516:Mroh7 UTSW 4 106691119 missense probably benign 0.00
R7525:Mroh7 UTSW 4 106709702 missense probably benign 0.22
R7540:Mroh7 UTSW 4 106720398 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTATTGCTCTGAGAGACTGAGGC -3'
(R):5'- TCATTCCTTGTGGGCATGC -3'

Sequencing Primer
(F):5'- GAGACTGAGGCTGATTCTCTAATCC -3'
(R):5'- TGGGCATGCTCACGAATAC -3'
Posted On2014-10-01