Incidental Mutation 'R2162:Zcchc17'
ID235197
Institutional Source Beutler Lab
Gene Symbol Zcchc17
Ensembl Gene ENSMUSG00000028772
Gene Namezinc finger, CCHC domain containing 17
SynonymsHSPC251, Ps1d, 2810055E05Rik
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130315383-130359943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130338524 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 62 (D62G)
Ref Sequence ENSEMBL: ENSMUSP00000120807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134159]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129840
Predicted Effect probably benign
Transcript: ENSMUST00000134159
AA Change: D62G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772
AA Change: D62G

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Predicted Effect
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Specific KO of the short isoform reduces osteogenic differentiation of mesenchymal stem cells and results in early cellular senescence in the embryonic notochord and forelimb bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Zcchc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Zcchc17 APN 4 130337109 missense probably benign 0.01
IGL02086:Zcchc17 APN 4 130316647 makesense probably null
IGL02277:Zcchc17 APN 4 130327221 missense probably benign 0.15
IGL02395:Zcchc17 APN 4 130337127 missense probably damaging 1.00
IGL02407:Zcchc17 APN 4 130349315 missense probably benign
R0105:Zcchc17 UTSW 4 130349306 missense probably benign 0.36
R0105:Zcchc17 UTSW 4 130349306 missense probably benign 0.36
R0245:Zcchc17 UTSW 4 130337154 missense probably benign
R1026:Zcchc17 UTSW 4 130329610 missense possibly damaging 0.95
R1764:Zcchc17 UTSW 4 130329595 missense probably damaging 0.97
R2389:Zcchc17 UTSW 4 130327204 nonsense probably null
R3831:Zcchc17 UTSW 4 130338524 missense probably benign 0.04
R4078:Zcchc17 UTSW 4 130329625 missense possibly damaging 0.65
R5553:Zcchc17 UTSW 4 130354134 critical splice donor site probably null
R7233:Zcchc17 UTSW 4 130327323 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAGAGTCCCATGAACACAC -3'
(R):5'- TGACTGGGTTAAAGGCTGATC -3'

Sequencing Primer
(F):5'- GAAGATTCAAACTCAAGACAGATGAC -3'
(R):5'- CTGGGTTAAAGGCTGATCTTAAATTG -3'
Posted On2014-10-01