Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Atp6v0a4'

235203

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a4

Ensembl Gene

ENSMUSG00000038600

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A4

Synonyms

V-ATPase alpha 4, Atp6n1b

MMRRC Submission

040165-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38048483-38124586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 38088646 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 128 (K128N)

Ref Sequence

ENSEMBL: ENSMUSP00000110558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040259
AA Change: K128N

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: K128N

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	824	3.5e-293	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114908
AA Change: K128N

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: K128N

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	823	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138385

Meta Mutation Damage Score

0.1421

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Atp6v0a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Atp6v0a4	APN	6	38092790	nonsense	probably null
IGL01358:Atp6v0a4	APN	6	38074210	missense	probably damaging	1.00
IGL01781:Atp6v0a4	APN	6	38074160	missense	possibly damaging	0.91
IGL01934:Atp6v0a4	APN	6	38051546	missense	possibly damaging	0.90
IGL01953:Atp6v0a4	APN	6	38054617	missense	probably damaging	0.97
IGL03190:Atp6v0a4	APN	6	38054556	missense	probably benign	0.02
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0049:Atp6v0a4	UTSW	6	38082081	missense	probably damaging	1.00
R0100:Atp6v0a4	UTSW	6	38076815	missense	probably benign
R0105:Atp6v0a4	UTSW	6	38053129	splice site	probably benign
R1569:Atp6v0a4	UTSW	6	38050625	missense	probably damaging	1.00
R1754:Atp6v0a4	UTSW	6	38067829	missense	probably benign
R2142:Atp6v0a4	UTSW	6	38082936	nonsense	probably null
R2433:Atp6v0a4	UTSW	6	38082029	critical splice donor site	probably null
R2892:Atp6v0a4	UTSW	6	38053017	missense	probably benign	0.00
R4599:Atp6v0a4	UTSW	6	38078802	missense	probably benign	0.01
R4687:Atp6v0a4	UTSW	6	38092465	missense	possibly damaging	0.95
R4716:Atp6v0a4	UTSW	6	38061064	missense	probably damaging	1.00
R4938:Atp6v0a4	UTSW	6	38078814	missense	possibly damaging	0.80
R5062:Atp6v0a4	UTSW	6	38074183	missense	probably benign	0.05
R5437:Atp6v0a4	UTSW	6	38076733	missense	probably damaging	0.97
R5440:Atp6v0a4	UTSW	6	38092817	missense	probably damaging	0.96
R5697:Atp6v0a4	UTSW	6	38050507	splice site	probably null
R5698:Atp6v0a4	UTSW	6	38050507	splice site	probably null
R6425:Atp6v0a4	UTSW	6	38050511	missense	possibly damaging	0.88
R7659:Atp6v0a4	UTSW	6	38071972	missense	probably damaging	1.00
R8004:Atp6v0a4	UTSW	6	38050549	missense	possibly damaging	0.93
R8270:Atp6v0a4	UTSW	6	38074229	missense	probably damaging	1.00
Z1176:Atp6v0a4	UTSW	6	38049036	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CAATTGAGCCCGCATCACTG -3'
(R):5'- ACTGCCTCTTTGATGGCTGG -3'

Sequencing Primer
(F):5'- AGCCCGCATCACTGCTACTG -3'
(R):5'- CTGGTTAGTGACTGTGGCTAC -3'

Posted On

2014-10-01