Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Bcat1'

235204

Institutional Source

Beutler Lab

Gene Symbol

Bcat1

Ensembl Gene

ENSMUSG00000030268

Gene Name

branched chain aminotransferase 1, cytosolic

Synonyms

Eca39, Bcat-1, BCATc

MMRRC Submission

040165-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R2162 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

144993835-145076184 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 145010108 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 349 (D349V)

Ref Sequence

ENSEMBL: ENSMUSP00000032402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032402] [ENSMUST00000048252] [ENSMUST00000111742] [ENSMUST00000204138]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032402
AA Change: D349V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032402
Gene: ENSMUSG00000030268
AA Change: D349V

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	160	410	1.3e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000048252
AA Change: D282V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039744
Gene: ENSMUSG00000030268
AA Change: D282V

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	111	354	5.9e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111742
AA Change: D282V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107371
Gene: ENSMUSG00000030268
AA Change: D282V

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	111	354	1.7e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145911

Predicted Effect

probably damaging
Transcript: ENSMUST00000204138
AA Change: D152V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144968
Gene: ENSMUSG00000030268
AA Change: D152V

Domain	Start	End	E-Value	Type
Pfam:Aminotran_4	34	180	9.1e-17	PFAM

Meta Mutation Damage Score

0.8289

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null mutation display abnormal amino acid metabilism in T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Bcat1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Bcat1	APN	6	145000289	missense	possibly damaging	0.89
IGL01882:Bcat1	APN	6	145004409	missense	probably damaging	1.00
IGL02021:Bcat1	APN	6	145047289	splice site	probably benign
IGL02024:Bcat1	APN	6	145032838	missense	probably damaging	0.97
IGL02705:Bcat1	APN	6	145019188	splice site	probably benign
IGL02954:Bcat1	APN	6	145019219	missense	probably damaging	1.00
R0331:Bcat1	UTSW	6	145047314	missense	probably benign	0.17
R1592:Bcat1	UTSW	6	145010058	missense	probably benign	0.00
R1680:Bcat1	UTSW	6	145039628	missense	probably damaging	1.00
R2306:Bcat1	UTSW	6	145007653	missense	probably damaging	0.96
R3498:Bcat1	UTSW	6	145019342	missense	probably damaging	0.99
R3758:Bcat1	UTSW	6	145032872	missense	probably damaging	1.00
R3831:Bcat1	UTSW	6	145010108	missense	probably damaging	1.00
R3833:Bcat1	UTSW	6	145010108	missense	probably damaging	1.00
R4829:Bcat1	UTSW	6	145015475	missense	probably damaging	1.00
R5250:Bcat1	UTSW	6	145047439	critical splice donor site	probably null
R5338:Bcat1	UTSW	6	145007627	missense	possibly damaging	0.50
R5414:Bcat1	UTSW	6	145015447	critical splice donor site	probably null
R5679:Bcat1	UTSW	6	145007748	missense	probably damaging	1.00
R6566:Bcat1	UTSW	6	145015484	missense	probably damaging	1.00
R7015:Bcat1	UTSW	6	145039583	missense	probably damaging	0.99
R7255:Bcat1	UTSW	6	145032785	nonsense	probably null
R7606:Bcat1	UTSW	6	145048632	missense	probably benign	0.06
RF004:Bcat1	UTSW	6	145007623	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGCAAAGCAAAGCTCATTTGG -3'
(R):5'- AGAGCTCTGGTCTGAGTAGC -3'

Sequencing Primer
(F):5'- CAAAGCTCATTTGGATTGTGTGTG -3'
(R):5'- CTCTGGTCTGAGTAGCAGCAG -3'

Posted On

2014-10-01