Incidental Mutation 'R2162:Vmn1r167'
ID235206
Institutional Source Beutler Lab
Gene Symbol Vmn1r167
Ensembl Gene ENSMUSG00000090715
Gene Namevomeronasal 1 receptor 167
SynonymsGm6279
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2162 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23503646-23507206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23504799 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 264 (D264G)
Ref Sequence ENSEMBL: ENSMUSP00000153774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164527] [ENSMUST00000227713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164527
AA Change: D264G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129193
Gene: ENSMUSG00000090715
AA Change: D264G

DomainStartEndE-ValueType
Pfam:TAS2R 19 307 1.5e-13 PFAM
Pfam:7tm_1 41 299 3.8e-6 PFAM
Pfam:V1R 52 306 2.1e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227713
AA Change: D264G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Vmn1r167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Vmn1r167 APN 7 23505439 missense probably damaging 0.98
IGL02261:Vmn1r167 APN 7 23504836 missense probably benign 0.17
IGL02963:Vmn1r167 APN 7 23505550 missense possibly damaging 0.60
R0054:Vmn1r167 UTSW 7 23504909 missense possibly damaging 0.89
R0555:Vmn1r167 UTSW 7 23505087 missense probably damaging 1.00
R0766:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1312:Vmn1r167 UTSW 7 23505123 missense probably benign 0.01
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1464:Vmn1r167 UTSW 7 23505256 missense possibly damaging 0.62
R1532:Vmn1r167 UTSW 7 23504779 missense probably benign 0.01
R1937:Vmn1r167 UTSW 7 23505027 missense probably benign 0.25
R4639:Vmn1r167 UTSW 7 23505586 missense probably benign 0.00
R4661:Vmn1r167 UTSW 7 23504692 missense probably damaging 1.00
R4845:Vmn1r167 UTSW 7 23504733 missense probably benign 0.01
R4868:Vmn1r167 UTSW 7 23504736 missense probably benign
R4993:Vmn1r167 UTSW 7 23505228 missense probably damaging 1.00
R5693:Vmn1r167 UTSW 7 23505221 nonsense probably null
R6622:Vmn1r167 UTSW 7 23505589 start codon destroyed probably null
R7800:Vmn1r167 UTSW 7 23504644 makesense probably null
R8297:Vmn1r167 UTSW 7 23504790 missense probably damaging 1.00
R8365:Vmn1r167 UTSW 7 23504775 missense probably benign 0.03
R8411:Vmn1r167 UTSW 7 23505556 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGAATGTTTGTCATTTGGACTCTC -3'
(R):5'- TAGGCATGCGCATCTTATCATTTG -3'

Sequencing Primer
(F):5'- GGACTCTCATTTTCAGCAGCAG -3'
(R):5'- CCATGATGGAGTGTTCATCAGCATC -3'
Posted On2014-10-01