Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Zfp280d'

235212

Institutional Source

Beutler Lab

Gene Symbol

Zfp280d

Ensembl Gene

ENSMUSG00000038535

Gene Name

zinc finger protein 280D

Synonyms

Suhw4

MMRRC Submission

040165-MU

Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene?

Possibly non essential (E-score: 0.424) question?

Stock #

R2162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72274860-72363777 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72298822 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 62 (I62K)

Ref Sequence

ENSEMBL: ENSMUSP00000138848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]

Predicted Effect

probably damaging
Transcript: ENSMUST00000098576
AA Change: I62K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	241	6.8e-82	PFAM
ZnF_C2H2	252	272	1.24e2	SMART
ZnF_C2H2	333	355	6.92e0	SMART
ZnF_C2H2	370	393	3.99e0	SMART
ZnF_C2H2	400	423	1.08e-1	SMART
ZnF_C2H2	430	453	3.52e-1	SMART
ZnF_C2H2	459	481	2.41e1	SMART
ZnF_C2H2	487	509	3.38e1	SMART
low complexity region	539	561	N/A	INTRINSIC
low complexity region	591	611	N/A	INTRINSIC
ZnF_C2H2	656	679	1.23e1	SMART
ZnF_C2H2	702	726	1.34e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183400

Predicted Effect

probably damaging
Transcript: ENSMUST00000183410
AA Change: I62K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	242	4.1e-98	PFAM
ZnF_C2H2	252	272	1.24e2	SMART
ZnF_C2H2	333	355	6.92e0	SMART
ZnF_C2H2	370	393	3.99e0	SMART
ZnF_C2H2	400	423	1.08e-1	SMART
ZnF_C2H2	430	453	3.52e-1	SMART
ZnF_C2H2	459	481	2.41e1	SMART
ZnF_C2H2	487	509	3.38e1	SMART
low complexity region	539	561	N/A	INTRINSIC
low complexity region	591	611	N/A	INTRINSIC
ZnF_C2H2	656	679	1.23e1	SMART
ZnF_C2H2	702	726	1.34e2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183801
AA Change: I62K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	242	1.9e-98	PFAM
ZnF_C2H2	252	272	1.24e2	SMART
ZnF_C2H2	333	355	6.92e0	SMART
ZnF_C2H2	370	393	3.99e0	SMART
ZnF_C2H2	400	423	1.08e-1	SMART
ZnF_C2H2	430	453	3.52e-1	SMART
ZnF_C2H2	459	481	2.41e1	SMART
ZnF_C2H2	487	509	3.38e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184036
AA Change: I37K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535
AA Change: I37K

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	18	30	N/A	INTRINSIC
Pfam:DUF4195	32	217	5.5e-98	PFAM
ZnF_C2H2	227	247	1.24e2	SMART
ZnF_C2H2	308	330	6.92e0	SMART
ZnF_C2H2	345	368	3.99e0	SMART
ZnF_C2H2	375	398	1.08e-1	SMART
ZnF_C2H2	405	428	3.52e-1	SMART
ZnF_C2H2	434	456	2.41e1	SMART
ZnF_C2H2	462	484	3.38e1	SMART
low complexity region	514	536	N/A	INTRINSIC
low complexity region	566	586	N/A	INTRINSIC
ZnF_C2H2	631	654	1.23e1	SMART
ZnF_C2H2	677	701	1.34e2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184053
AA Change: I62K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	147	1e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000184399
AA Change: I62K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	103	4.8e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000184517
AA Change: I62K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: I62K

Domain	Start	End	E-Value	Type
low complexity region	28	39	N/A	INTRINSIC
low complexity region	43	55	N/A	INTRINSIC
Pfam:DUF4195	57	242	2.2e-98	PFAM
ZnF_C2H2	252	272	1.24e2	SMART
ZnF_C2H2	333	355	6.92e0	SMART
ZnF_C2H2	370	393	3.99e0	SMART
ZnF_C2H2	400	423	1.08e-1	SMART
ZnF_C2H2	430	453	3.52e-1	SMART
ZnF_C2H2	459	481	2.41e1	SMART
ZnF_C2H2	487	509	3.38e1	SMART
low complexity region	539	561	N/A	INTRINSIC
low complexity region	591	611	N/A	INTRINSIC
ZnF_C2H2	656	679	1.23e1	SMART
ZnF_C2H2	702	726	1.34e2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000184786
AA Change: I32K

Meta Mutation Damage Score

0.1701

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Slit3	A	T	11: 35,688,682	S1229C	probably null	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Zfp280d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Zfp280d	APN	9	72322571	missense	probably damaging	1.00
IGL00708:Zfp280d	APN	9	72312135	missense	probably benign	0.19
IGL01333:Zfp280d	APN	9	72335114	splice site	probably benign
IGL01453:Zfp280d	APN	9	72322586	missense	possibly damaging	0.90
IGL02472:Zfp280d	APN	9	72301711	missense	probably damaging	1.00
IGL02583:Zfp280d	APN	9	72322445	splice site	probably benign
IGL02608:Zfp280d	APN	9	72307979	missense	probably damaging	0.98
IGL02675:Zfp280d	APN	9	72312222	missense	probably benign	0.33
IGL02676:Zfp280d	APN	9	72335074	missense	probably damaging	1.00
IGL02931:Zfp280d	APN	9	72296025	missense	probably benign	0.02
IGL03076:Zfp280d	APN	9	72312662	missense	probably damaging	0.99
R0017:Zfp280d	UTSW	9	72339010	critical splice acceptor site	probably null
R0017:Zfp280d	UTSW	9	72339010	critical splice acceptor site	probably null
R0288:Zfp280d	UTSW	9	72331339	nonsense	probably null
R0419:Zfp280d	UTSW	9	72312237	missense	probably benign	0.02
R0540:Zfp280d	UTSW	9	72307965	missense	probably damaging	0.97
R0628:Zfp280d	UTSW	9	72361948	missense	probably benign
R0722:Zfp280d	UTSW	9	72312101	missense	possibly damaging	0.63
R1055:Zfp280d	UTSW	9	72329167	splice site	probably null
R1786:Zfp280d	UTSW	9	72308005	missense	probably damaging	1.00
R1826:Zfp280d	UTSW	9	72298780	missense	probably damaging	1.00
R1962:Zfp280d	UTSW	9	72335080	nonsense	probably null
R2130:Zfp280d	UTSW	9	72308005	missense	probably damaging	1.00
R2132:Zfp280d	UTSW	9	72308005	missense	probably damaging	1.00
R2133:Zfp280d	UTSW	9	72308005	missense	probably damaging	1.00
R2143:Zfp280d	UTSW	9	72312729	missense	probably damaging	1.00
R2266:Zfp280d	UTSW	9	72301770	splice site	probably benign
R2269:Zfp280d	UTSW	9	72301770	splice site	probably benign
R2278:Zfp280d	UTSW	9	72338773	nonsense	probably null
R2850:Zfp280d	UTSW	9	72312089	missense	probably benign	0.06
R3780:Zfp280d	UTSW	9	72322524	missense	probably damaging	1.00
R3950:Zfp280d	UTSW	9	72296019	missense	possibly damaging	0.49
R4330:Zfp280d	UTSW	9	72295979	missense	possibly damaging	0.86
R4716:Zfp280d	UTSW	9	72312665	missense	possibly damaging	0.94
R4876:Zfp280d	UTSW	9	72298858	splice site	probably benign
R4909:Zfp280d	UTSW	9	72331432	missense	probably damaging	1.00
R5214:Zfp280d	UTSW	9	72308113	unclassified	probably benign
R5518:Zfp280d	UTSW	9	72324135	missense	probably damaging	0.99
R5853:Zfp280d	UTSW	9	72330942	missense	probably benign	0.20
R5945:Zfp280d	UTSW	9	72362332	nonsense	probably null
R6033:Zfp280d	UTSW	9	72329137	missense	probably damaging	1.00
R6033:Zfp280d	UTSW	9	72329137	missense	probably damaging	1.00
R7043:Zfp280d	UTSW	9	72319257	missense	probably damaging	1.00
R7501:Zfp280d	UTSW	9	72361942	missense	possibly damaging	0.65
R7658:Zfp280d	UTSW	9	72324072	missense	probably damaging	1.00
R7667:Zfp280d	UTSW	9	72301965	missense	probably damaging	1.00
R7792:Zfp280d	UTSW	9	72331319	missense	probably damaging	1.00
R7826:Zfp280d	UTSW	9	72312671	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GACGTAGCAGGATCTCAGTTTC -3'
(R):5'- CTCAAACTCCACTCAGGGTC -3'

Sequencing Primer
(F):5'- CGTAGCAGGATCTCAGTTTCTTATTG -3'
(R):5'- TCAACCCTGACTTTCAAACAAG -3'

Posted On

2014-10-01