Mutagenetix > Incidental Mutations

Incidental Mutation 'R2162:Slit3'

235219

Institutional Source

Beutler Lab

Gene Symbol

Slit3

Ensembl Gene

ENSMUSG00000056427

Gene Name

slit guidance ligand 3

Synonyms

Slit1

MMRRC Submission

040165-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.794) question?

Stock #

R2162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35121224-35708507 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35688682 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 1229 (S1229C)

Ref Sequence

ENSEMBL: ENSMUSP00000066857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069837] [ENSMUST00000069837]

Predicted Effect

probably null
Transcript: ENSMUST00000069837
AA Change: S1229C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: S1229C

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000069837
AA Change: S1229C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: S1229C

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
LRRNT	33	65	2.12e-8	SMART
LRR	59	83	1.37e2	SMART
LRR_TYP	84	107	1.12e-3	SMART
LRR_TYP	108	131	7.78e-3	SMART
LRR_TYP	132	155	5.42e-2	SMART
LRR	156	179	5.88e0	SMART
LRR	180	203	7.55e-1	SMART
LRRCT	215	264	1.33e-6	SMART
LRRNT	279	311	6.79e-7	SMART
LRR	305	329	1.16e2	SMART
LRR	330	353	1.26e1	SMART
LRR_TYP	354	377	2.79e-4	SMART
LRR	378	401	4.05e-1	SMART
LRR	402	425	4.05e-1	SMART
LRRCT	437	486	7.75e-8	SMART
LRRNT	504	536	1.95e-7	SMART
LRR_TYP	556	579	7.49e-5	SMART
LRR	581	603	6.41e1	SMART
LRR_TYP	604	627	2.53e-2	SMART
LRR	628	651	1.76e-1	SMART
LRRCT	663	712	2.52e-7	SMART
LRRNT	724	756	3e-8	SMART
LRR	774	797	2.14e0	SMART
LRR_TYP	798	821	2.95e-3	SMART
LRR_TYP	822	845	2.43e-4	SMART
LRRCT	857	906	1.12e-13	SMART
EGF	919	953	6.86e-4	SMART
EGF	958	994	8.84e-7	SMART
EGF	999	1032	1.13e-4	SMART
EGF	1037	1072	2.3e-5	SMART
EGF_CA	1074	1110	5.92e-8	SMART
EGF	1122	1155	3.79e-6	SMART
LamG	1178	1314	3.16e-34	SMART
EGF	1331	1365	2.19e-2	SMART
EGF	1371	1403	1.13e-4	SMART
EGF	1411	1444	5.57e-4	SMART
CT	1455	1523	4.56e-5	SMART

Meta Mutation Damage Score

0.7421

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	G	4: 42,972,238	T524A	possibly damaging	Het
Adamts20	A	C	15: 94,331,458	C927G	probably damaging	Het
Afdn	T	A	17: 13,896,174	D190E	probably benign	Het
Ankrd28	T	C	14: 31,708,762	D850G	probably damaging	Het
Arhgap45	T	C	10: 80,016,979	M1T	probably null	Het
Atp6v0a4	T	G	6: 38,088,646	K128N	possibly damaging	Het
Bcat1	T	A	6: 145,010,108	D349V	probably damaging	Het
Cacna1i	T	C	15: 80,356,187	F370S	probably damaging	Het
Clca4b	T	C	3: 144,928,587	I82V	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cyfip2	T	C	11: 46,261,506	D485G	probably benign	Het
Cyp27b1	G	T	10: 127,051,060	V382L	probably damaging	Het
Dnaaf5	T	C	5: 139,181,565	V447A	possibly damaging	Het
Dpp9	A	T	17: 56,199,113	F429I	possibly damaging	Het
Eng	C	T	2: 32,679,047	R528C	probably damaging	Het
Gcn1l1	A	T	5: 115,592,132	Q835L	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Hlx	T	A	1: 184,730,692		probably null	Het
Htt	T	A	5: 34,821,718	V815D	probably benign	Het
Il1f5	G	T	2: 24,279,680	L17F	probably damaging	Het
Itga1	C	T	13: 115,030,910	V157I	probably benign	Het
Krtap19-3	T	G	16: 88,877,719	*88C	probably null	Het
Lzic	G	C	4: 149,488,728	E112D	probably null	Het
Mark2	G	C	19: 7,282,747	S111C	probably damaging	Het
Mep1b	C	T	18: 21,086,239	T150I	possibly damaging	Het
Mroh7	G	C	4: 106,700,181	S777R	probably damaging	Het
Nrxn1	G	A	17: 90,162,431	R35C	probably damaging	Het
Olfr1145	T	A	2: 87,810,360	I180K	probably damaging	Het
Olfr494	C	A	7: 108,367,562	P24Q	probably benign	Het
Olfr624	T	G	7: 103,670,872	Q53P	possibly damaging	Het
Pacs2	A	G	12: 113,050,947	T243A	probably benign	Het
Pan2	A	G	10: 128,304,222	E4G	possibly damaging	Het
Pdp1	A	G	4: 11,961,123	V396A	probably damaging	Het
Pdzd7	A	G	19: 45,036,055		probably null	Het
Peg10	T	A	6: 4,755,914		probably benign	Het
Pgc	C	A	17: 47,729,311	F93L	probably null	Het
Piezo2	A	G	18: 63,081,662		probably null	Het
Pja2	T	C	17: 64,309,402	D166G	probably benign	Het
Ppp1r9b	T	C	11: 94,998,051	L97P	probably damaging	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
S100a10	T	C	3: 93,564,373	V88A	probably damaging	Het
Scn9a	T	A	2: 66,534,229	Y789F	probably damaging	Het
Sptan1	T	C	2: 30,018,576		probably benign	Het
Srrd	G	T	5: 112,342,944		probably benign	Het
Tdrd3	A	G	14: 87,480,785	T201A	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Ttll4	A	G	1: 74,686,391	K653E	probably damaging	Het
Usp43	A	G	11: 67,879,969	L613P	probably damaging	Het
Vmn1r167	T	C	7: 23,504,799	D264G	possibly damaging	Het
Whamm	A	G	7: 81,571,341	D7G	probably damaging	Het
Zcchc17	T	C	4: 130,338,524	D62G	probably benign	Het
Zfp280d	T	A	9: 72,298,822	I62K	probably damaging	Het
Zfp445	T	G	9: 122,852,476	E800A	probably damaging	Het
Zfp516	A	G	18: 82,986,938	R656G	possibly damaging	Het

Other mutations in Slit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00731:Slit3	APN	11	35622154	missense	probably damaging	1.00
IGL01324:Slit3	APN	11	35610702	missense	probably damaging	1.00
IGL01612:Slit3	APN	11	35700384	missense	possibly damaging	0.95
IGL02145:Slit3	APN	11	35629742	missense	probably damaging	0.99
IGL02146:Slit3	APN	11	35234848	missense	possibly damaging	0.71
IGL02430:Slit3	APN	11	35177774	splice site	probably null
IGL02528:Slit3	APN	11	35578974	missense	probably benign
IGL02530:Slit3	APN	11	35708142	makesense	probably null
IGL02640:Slit3	APN	11	35700345	missense	probably benign	0.10
IGL02819:Slit3	APN	11	35171590	missense	possibly damaging	0.71
IGL02839:Slit3	APN	11	35649047	missense	possibly damaging	0.46
IGL03150:Slit3	APN	11	35508257	missense	possibly damaging	0.88
IGL03161:Slit3	APN	11	35700414	missense	probably benign	0.10
IGL03336:Slit3	APN	11	35670101	missense	probably damaging	0.97
Bloated	UTSW	11	35633952	missense	possibly damaging	0.55
Quellung	UTSW	11	35651820	critical splice donor site	probably null
IGL02988:Slit3	UTSW	11	35708063	missense	probably damaging	0.99
PIT4791001:Slit3	UTSW	11	35661245	missense	possibly damaging	0.85
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0013:Slit3	UTSW	11	35707918	missense	probably benign
R0334:Slit3	UTSW	11	35579101	missense	probably damaging	0.97
R0385:Slit3	UTSW	11	35700282	missense	probably damaging	0.98
R0840:Slit3	UTSW	11	35623436	splice site	probably benign
R1065:Slit3	UTSW	11	35121635	missense	possibly damaging	0.86
R1364:Slit3	UTSW	11	35670107	missense	probably benign
R1476:Slit3	UTSW	11	35686299	missense	probably damaging	0.97
R1508:Slit3	UTSW	11	35570621	missense	probably damaging	1.00
R1665:Slit3	UTSW	11	35234906	missense	possibly damaging	0.71
R1692:Slit3	UTSW	11	35659344	missense	probably damaging	1.00
R1696:Slit3	UTSW	11	35675923	missense	probably damaging	0.99
R1727:Slit3	UTSW	11	35629832	missense	probably damaging	1.00
R1752:Slit3	UTSW	11	35564653	missense	probably damaging	0.98
R1970:Slit3	UTSW	11	35630841	critical splice acceptor site	probably null
R2077:Slit3	UTSW	11	35544748	missense	possibly damaging	0.88
R2126:Slit3	UTSW	11	35688679	missense	probably damaging	1.00
R2143:Slit3	UTSW	11	35612261	splice site	probably null
R2873:Slit3	UTSW	11	35544793	nonsense	probably null
R3813:Slit3	UTSW	11	35675979	missense	probably damaging	1.00
R3831:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3832:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3833:Slit3	UTSW	11	35688682	missense	probably null	1.00
R3839:Slit3	UTSW	11	35508237	missense	probably benign	0.10
R4152:Slit3	UTSW	11	35698320	missense	probably damaging	0.98
R4387:Slit3	UTSW	11	35684048	missense	probably benign	0.12
R4795:Slit3	UTSW	11	35651820	critical splice donor site	probably null
R4910:Slit3	UTSW	11	35632722	missense	probably damaging	0.99
R4933:Slit3	UTSW	11	35688593	missense	probably damaging	1.00
R5048:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5106:Slit3	UTSW	11	35612367	missense	probably damaging	1.00
R5138:Slit3	UTSW	11	35588985	missense	probably damaging	1.00
R5218:Slit3	UTSW	11	35684175	critical splice donor site	probably null
R5338:Slit3	UTSW	11	35622148	missense	probably benign
R5354:Slit3	UTSW	11	35675913	missense	probably damaging	1.00
R5436:Slit3	UTSW	11	35707911	missense	probably benign	0.05
R5896:Slit3	UTSW	11	35708105	missense	probably damaging	0.99
R5933:Slit3	UTSW	11	35629751	missense	probably benign	0.04
R5963:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R5964:Slit3	UTSW	11	35700236	missense	probably damaging	1.00
R6125:Slit3	UTSW	11	35570733	critical splice donor site	probably null
R6153:Slit3	UTSW	11	35700483	missense	possibly damaging	0.69
R6484:Slit3	UTSW	11	35661298	missense	probably benign
R6526:Slit3	UTSW	11	35661292	missense	probably benign	0.33
R6797:Slit3	UTSW	11	35633952	missense	possibly damaging	0.55
R6887:Slit3	UTSW	11	35544806	splice site	probably null
R7067:Slit3	UTSW	11	35508230	missense	probably benign	0.04
R7150:Slit3	UTSW	11	35570719	missense	probably damaging	1.00
R7228:Slit3	UTSW	11	35599418	missense	probably damaging	1.00
R7232:Slit3	UTSW	11	35610689	missense	possibly damaging	0.87
R7418:Slit3	UTSW	11	35686428	missense	possibly damaging	0.64
R7545:Slit3	UTSW	11	35700312	missense	possibly damaging	0.52
R7727:Slit3	UTSW	11	35684044	missense	probably damaging	1.00
R7820:Slit3	UTSW	11	35700408	missense	probably benign	0.23
R8177:Slit3	UTSW	11	35579092	missense	probably damaging	0.99
R8179:Slit3	UTSW	11	35664076	missense	probably benign	0.31
R8416:Slit3	UTSW	11	35508235	missense	probably benign	0.08
R8417:Slit3	UTSW	11	35610611	missense	probably damaging	0.99
R8476:Slit3	UTSW	11	35629769	missense	possibly damaging	0.70
X0028:Slit3	UTSW	11	35564637	missense	probably damaging	0.99
Z1176:Slit3	UTSW	11	35707924	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCATCTGAAGAGGGTGCTAG -3'
(R):5'- AATGAGGTGTCATCTCCCACATG -3'

Sequencing Primer
(F):5'- TCTGAAGAGGGTGCTAGGCATG -3'
(R):5'- ACATGGGCCTGCCTTCC -3'

Posted On

2014-10-01