Incidental Mutation 'R2162:Tectb'
ID235243
Institutional Source Beutler Lab
Gene Symbol Tectb
Ensembl Gene ENSMUSG00000024979
Gene Nametectorin beta
Synonyms[b]-tectorin, Tctnb
MMRRC Submission 040165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2162 (G1)
Quality Score192
Status Validated
Chromosome19
Chromosomal Location55180733-55196313 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to G at 55180999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025936] [ENSMUST00000120936] [ENSMUST00000154886]
Predicted Effect probably benign
Transcript: ENSMUST00000025936
SMART Domains Protein: ENSMUSP00000025936
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 283 3.47e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120936
SMART Domains Protein: ENSMUSP00000113805
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 293 1.9e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154886
SMART Domains Protein: ENSMUSP00000121767
Gene: ENSMUSG00000024979

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
ZP 31 196 6.19e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-collagenous glycoprotein component of the tectorial membrane, which covers the auditory hair cells in the cochlea of the inner ear. A similar protein in mouse functions in low-frequency hearing. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null allele show an enlarged tectorial membrane with a disrupted striated-sheet matrix, absence of the marginal band, and low-frequency hearing loss. However, basilar-membrane and neural tuning are both enhanced in high-frequency cochlear regions, with little loss in sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,238 T524A possibly damaging Het
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Ankrd28 T C 14: 31,708,762 D850G probably damaging Het
Arhgap45 T C 10: 80,016,979 M1T probably null Het
Atp6v0a4 T G 6: 38,088,646 K128N possibly damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Clca4b T C 3: 144,928,587 I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Eng C T 2: 32,679,047 R528C probably damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Hlx T A 1: 184,730,692 probably null Het
Htt T A 5: 34,821,718 V815D probably benign Het
Il1f5 G T 2: 24,279,680 L17F probably damaging Het
Itga1 C T 13: 115,030,910 V157I probably benign Het
Krtap19-3 T G 16: 88,877,719 *88C probably null Het
Lzic G C 4: 149,488,728 E112D probably null Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh7 G C 4: 106,700,181 S777R probably damaging Het
Nrxn1 G A 17: 90,162,431 R35C probably damaging Het
Olfr1145 T A 2: 87,810,360 I180K probably damaging Het
Olfr494 C A 7: 108,367,562 P24Q probably benign Het
Olfr624 T G 7: 103,670,872 Q53P possibly damaging Het
Pacs2 A G 12: 113,050,947 T243A probably benign Het
Pan2 A G 10: 128,304,222 E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 V396A probably damaging Het
Pdzd7 A G 19: 45,036,055 probably null Het
Peg10 T A 6: 4,755,914 probably benign Het
Pgc C A 17: 47,729,311 F93L probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r9b T C 11: 94,998,051 L97P probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scn9a T A 2: 66,534,229 Y789F probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Sptan1 T C 2: 30,018,576 probably benign Het
Srrd G T 5: 112,342,944 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Usp43 A G 11: 67,879,969 L613P probably damaging Het
Vmn1r167 T C 7: 23,504,799 D264G possibly damaging Het
Whamm A G 7: 81,571,341 D7G probably damaging Het
Zcchc17 T C 4: 130,338,524 D62G probably benign Het
Zfp280d T A 9: 72,298,822 I62K probably damaging Het
Zfp445 T G 9: 122,852,476 E800A probably damaging Het
Zfp516 A G 18: 82,986,938 R656G possibly damaging Het
Other mutations in Tectb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Tectb APN 19 55184013 missense probably damaging 1.00
IGL02001:Tectb APN 19 55189595 missense possibly damaging 0.48
IGL02510:Tectb APN 19 55191511 missense probably damaging 1.00
R0028:Tectb UTSW 19 55194677 missense probably benign 0.01
R0130:Tectb UTSW 19 55181961 missense probably damaging 0.99
R0586:Tectb UTSW 19 55181924 missense probably damaging 1.00
R0598:Tectb UTSW 19 55189586 nonsense probably null
R0655:Tectb UTSW 19 55189870 missense possibly damaging 0.78
R0708:Tectb UTSW 19 55191552 missense probably benign 0.37
R1314:Tectb UTSW 19 55183985 missense probably damaging 1.00
R1999:Tectb UTSW 19 55180999 start gained probably benign
R2000:Tectb UTSW 19 55180999 start gained probably benign
R2024:Tectb UTSW 19 55181929 missense probably damaging 1.00
R2148:Tectb UTSW 19 55180999 start gained probably benign
R2159:Tectb UTSW 19 55180999 start gained probably benign
R2160:Tectb UTSW 19 55180999 start gained probably benign
R2161:Tectb UTSW 19 55180999 start gained probably benign
R2355:Tectb UTSW 19 55180999 start gained probably benign
R2358:Tectb UTSW 19 55180999 start gained probably benign
R2495:Tectb UTSW 19 55180999 start gained probably benign
R2497:Tectb UTSW 19 55180999 start gained probably benign
R2511:Tectb UTSW 19 55180999 start gained probably benign
R2568:Tectb UTSW 19 55180999 start gained probably benign
R2570:Tectb UTSW 19 55180999 start gained probably benign
R2848:Tectb UTSW 19 55180999 start gained probably benign
R2897:Tectb UTSW 19 55180999 start gained probably benign
R2898:Tectb UTSW 19 55180999 start gained probably benign
R3712:Tectb UTSW 19 55180999 start gained probably benign
R5671:Tectb UTSW 19 55192627 missense probably benign 0.42
R5875:Tectb UTSW 19 55189626 missense possibly damaging 0.94
R6312:Tectb UTSW 19 55192662 frame shift probably null
R6315:Tectb UTSW 19 55191472 missense possibly damaging 0.73
R6366:Tectb UTSW 19 55181918 missense probably damaging 1.00
R7729:Tectb UTSW 19 55192672 missense
Predicted Primers PCR Primer
(F):5'- AGCATCACCGAGCTCTCTTG -3'
(R):5'- GGGGAAAGTCTGATTGGCACTG -3'

Sequencing Primer
(F):5'- TCACCGAGCTCTCTTGGAAAC -3'
(R):5'- AAGTCTGATTGGCACTGGGGAC -3'
Posted On2014-10-01