Incidental Mutation 'R2163:Axdnd1'
ID235250
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Nameaxonemal dynein light chain domain containing 1
SynonymsLOC381304, 9430070O13Rik
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156323509-156421159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 156392003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 337 (V337G)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000213088]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000027895
Predicted Effect probably damaging
Transcript: ENSMUST00000177824
AA Change: V272G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: V272G

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178036
AA Change: V337G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: V337G

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000180173
AA Change: V174G
Predicted Effect probably damaging
Transcript: ENSMUST00000213088
AA Change: V337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5396 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype Mice homozygous for disruptions in this gene display kidney glomerular defects leading to blood and urine chemistry abnormalities. Death usually occurs before 5 weeks of age.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156376663 missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156395442 missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156378389 missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156378386 missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156380886 missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156365689 missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156378380 critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156348960 missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156346701 missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156376544 missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156380774 splice site probably null
R2126:Axdnd1 UTSW 1 156333214 missense probably benign 0.03
R2169:Axdnd1 UTSW 1 156418309 missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156365651 missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156392749 missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156341870 missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156380858 missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156419270 missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156331639 missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156376646 missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156395559 splice site probably null
R4969:Axdnd1 UTSW 1 156395505 missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156420410 missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156335350 missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156398534 missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156351412 missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156341889 missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156348958 missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156365612 splice site probably null
R6208:Axdnd1 UTSW 1 156392856 intron probably benign
R6369:Axdnd1 UTSW 1 156392745 missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156380813 missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156330962 intron probably null
R7115:Axdnd1 UTSW 1 156380876 missense
R7203:Axdnd1 UTSW 1 156382389 missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156382477 missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156418232 critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156376516 missense
R7686:Axdnd1 UTSW 1 156395464 nonsense probably null
R7793:Axdnd1 UTSW 1 156338743 critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156392801 nonsense probably null
X0009:Axdnd1 UTSW 1 156388079 missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156376535 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTTACATGCCAGCCACCTG -3'
(R):5'- TAAAAGGTGTGCCTGCCACC -3'

Sequencing Primer
(F):5'- CCACCTGAGGCTGGGGAAAG -3'
(R):5'- AGGTGTGCCTGCCACCTAATG -3'
Posted On2014-10-01