Mutagenetix > Incidental Mutation

Incidental Mutation 'R2163:Adamts3'

235270

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

040166-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2163 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89708718 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 332 (V332A)

Ref Sequence

ENSEMBL: ENSMUSP00000058552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]

AlphaFold

E9Q287

Predicted Effect

probably damaging
Transcript: ENSMUST00000061427
AA Change: V332A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: V332A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163159
AA Change: V332A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: V332A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Meta Mutation Damage Score

0.3648

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	C	11: 23,576,826		probably benign	Het
2410089E03Rik	T	A	15: 8,203,251		probably null	Het
4930578I07Rik	C	A	14: 66,938,548	T64K	unknown	Het
Ablim2	T	C	5: 35,802,353		probably benign	Het
Acp4	T	C	7: 44,255,976	D107G	probably damaging	Het
Adamts2	T	A	11: 50,788,805	C871S	probably benign	Het
Alkal1	C	T	1: 6,389,512	T104M	probably benign	Het
Astn1	A	G	1: 158,502,150	S192G	probably damaging	Het
Axdnd1	A	C	1: 156,392,003	V337G	probably damaging	Het
Baiap2l2	T	C	15: 79,259,195	D481G	possibly damaging	Het
Cacna2d1	C	T	5: 16,362,319	T964I	probably damaging	Het
Carf	T	C	1: 60,147,486		probably benign	Het
Catsper2	T	C	2: 121,400,175	D295G	probably damaging	Het
Cdh1	A	G	8: 106,649,081	T84A	probably benign	Het
Chd8	T	A	14: 52,198,818	H2508L	possibly damaging	Het
Chl1	A	T	6: 103,711,231	T284S	probably damaging	Het
Chtop	A	T	3: 90,502,211	M125K	probably benign	Het
Col14a1	T	A	15: 55,444,645		probably benign	Het
Cyp2b10	A	T	7: 25,925,385		probably benign	Het
Cyp2c70	G	A	19: 40,160,719	H328Y	possibly damaging	Het
Dcbld1	A	G	10: 52,286,356	T77A	probably damaging	Het
Dnah6	A	T	6: 73,089,746		probably null	Het
Efhd1	A	T	1: 87,289,473	D104V	probably damaging	Het
Eif5b	A	T	1: 38,048,794	D957V	probably benign	Het
Eps15	T	A	4: 109,370,669	S549R	probably damaging	Het
Fbxo3	C	A	2: 104,054,985	H400N	probably benign	Het
Fcer1a	A	G	1: 173,222,697	V86A	probably damaging	Het
Fh1	A	G	1: 175,614,840	M148T	possibly damaging	Het
Foxc1	C	A	13: 31,808,603	H466N	unknown	Het
Gadl1	T	A	9: 115,949,558	I180N	possibly damaging	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm21718	T	C	14: 51,317,766		noncoding transcript	Het
Gm6614	G	A	6: 141,980,938	T554I	possibly damaging	Het
Hivep2	T	A	10: 14,128,226	Y189*	probably null	Het
Hoxd13	T	A	2: 74,669,069	S254T	possibly damaging	Het
Hspd1	A	G	1: 55,078,538		probably benign	Het
Il1r1	A	G	1: 40,294,863	M198V	probably benign	Het
Katnal1	T	A	5: 148,888,936	I362F	probably damaging	Het
Muc2	CGTG	CGTGTG	7: 141,699,185		probably null	Het
Mybpc1	T	C	10: 88,540,942		probably benign	Het
Mycbp2	A	G	14: 103,169,855		probably null	Het
Nell2	G	T	15: 95,429,978	N301K	probably damaging	Het
Nenf	T	A	1: 191,309,935	D108V	probably damaging	Het
Nfkbiz	T	C	16: 55,818,218	N293S	probably benign	Het
Nipbl	T	C	15: 8,336,919	K1229E	probably damaging	Het
Nlrp4a	T	C	7: 26,453,397	F631L	probably benign	Het
Nrp1	T	A	8: 128,497,871	V705E	probably damaging	Het
Nsf	G	C	11: 103,863,333	A459G	possibly damaging	Het
Olfr1128	A	G	2: 87,544,894	S217P	probably damaging	Het
Olfr366	A	G	2: 37,220,077	E196G	probably damaging	Het
Pdia4	C	T	6: 47,798,407	D490N	possibly damaging	Het
Pinlyp	T	A	7: 24,541,801	Y192F	probably benign	Het
Pkd2	T	C	5: 104,455,677		probably benign	Het
Ppara	A	G	15: 85,801,046	K399E	probably benign	Het
Ppp4r2	C	A	6: 100,865,086	N169K	probably damaging	Het
Prom1	T	A	5: 44,014,163	E632V	possibly damaging	Het
Rpap3	T	A	15: 97,680,348	Y562F	possibly damaging	Het
Rsph14	T	A	10: 74,957,779	K263N	probably damaging	Het
Scn11a	T	G	9: 119,755,025	D1508A	probably damaging	Het
Scn7a	T	C	2: 66,675,956	T1530A	probably damaging	Het
Sec14l1	T	A	11: 117,143,282		probably null	Het
Slc4a4	A	G	5: 89,214,576	I840V	probably damaging	Het
Slco1c1	T	A	6: 141,559,752	V419D	probably benign	Het
Sltm	T	A	9: 70,591,682	F1013I	probably damaging	Het
Spam1	A	G	6: 24,796,847	K266E	probably benign	Het
Syt15	A	G	14: 34,226,116	E306G	probably benign	Het
Tap1	A	T	17: 34,189,473		probably null	Het
Tbc1d16	G	C	11: 119,155,078		probably benign	Het
Tex47	T	C	5: 7,305,022	Y68H	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttn	T	C	2: 76,812,501	T13264A	probably damaging	Het
Ubxn2a	A	T	12: 4,885,757	F131Y	probably damaging	Het
Usp40	T	C	1: 87,995,858		probably benign	Het
Vmn1r170	T	C	7: 23,607,037	L288P	probably damaging	Het
Vmn1r175	A	G	7: 23,808,927	Y92H	probably benign	Het
Wdpcp	G	T	11: 21,885,015	E673*	probably null	Het
Zfr	T	A	15: 12,162,223	L820I	probably damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7098:Adamts3	UTSW	5	89861495	missense	probably damaging	1.00
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTTGGGGTTTCGCTTGAAAAC -3'
(R):5'- ATGCCTGTTTCTGTGGACATTC -3'

Sequencing Primer
(F):5'- GTTTCGCTTGAAAACCCAGG -3'
(R):5'- ACAGGTGGCATGTGACCTCAC -3'

Posted On

2014-10-01