Incidental Mutation 'R2163:Cdh1'
ID235287
Institutional Source Beutler Lab
Gene Symbol Cdh1
Ensembl Gene ENSMUSG00000000303
Gene Namecadherin 1
SynonymsEcad, UM, uvomorulin, E-cad, L-CAM, E-cadherin
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106603351-106670246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106649081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 84 (T84A)
Ref Sequence ENSEMBL: ENSMUSP00000132112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000312] [ENSMUST00000167688]
Predicted Effect probably benign
Transcript: ENSMUST00000000312
AA Change: T84A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000000312
Gene: ENSMUSG00000000303
AA Change: T84A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 5.3e-11 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 734 881 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136580
Predicted Effect probably benign
Transcript: ENSMUST00000167688
AA Change: T84A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132112
Gene: ENSMUSG00000000303
AA Change: T84A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Cadherin_pro 29 118 3.42e-36 SMART
low complexity region 123 131 N/A INTRINSIC
CA 179 262 2.27e-14 SMART
CA 286 375 3.18e-27 SMART
CA 398 487 2e-10 SMART
CA 510 595 1.49e-18 SMART
Pfam:Cadherin 600 688 7.1e-10 PFAM
transmembrane domain 711 733 N/A INTRINSIC
Pfam:Cadherin_C 738 880 3.9e-50 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes E-cadherin, a calcium-dependent cell adhesion molecule that functions in the establishment and maintenance of epithelial cell morphology during embryongenesis and adulthood. The encoded preproprotein undergoes proteolytic processing to generate a mature protein. Targeted mutations disrupting binding of calcium to the encoded protein in mice cause death in utero due to failed blastocyst and trophectoderm formation. This gene is located adjacent to a related cadherin gene on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: In mutant homozygotes, adhesive cells of the morula dissociate shortly after initial compaction, probably due to depletion of maternal protein. Mutant embryos fail to form a trophectodermal epithelium or blastocyst cavity, and die near implantation time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppara A G 15: 85,801,046 K399E probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Cdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Cdh1 APN 8 106660884 missense probably damaging 1.00
IGL01405:Cdh1 APN 8 106649001 missense probably damaging 0.97
IGL01410:Cdh1 APN 8 106657853 missense probably benign 0.19
IGL01901:Cdh1 APN 8 106657760 missense probably damaging 0.99
IGL02197:Cdh1 APN 8 106653786 missense probably benign 0.29
IGL02580:Cdh1 APN 8 106649018 missense probably benign 0.01
IGL02690:Cdh1 APN 8 106657884 missense probably damaging 1.00
IGL02732:Cdh1 APN 8 106666323 missense probably damaging 1.00
IGL02927:Cdh1 APN 8 106668511 missense probably damaging 1.00
R1777:Cdh1 UTSW 8 106656835 missense probably damaging 1.00
R1826:Cdh1 UTSW 8 106666266 missense probably benign 0.03
R1892:Cdh1 UTSW 8 106664250 missense possibly damaging 0.72
R2045:Cdh1 UTSW 8 106666182 splice site probably benign
R2100:Cdh1 UTSW 8 106659668 missense possibly damaging 0.57
R2104:Cdh1 UTSW 8 106653759 splice site probably benign
R2118:Cdh1 UTSW 8 106664210 missense probably benign
R2121:Cdh1 UTSW 8 106664210 missense probably benign
R2124:Cdh1 UTSW 8 106664210 missense probably benign
R2125:Cdh1 UTSW 8 106656840 missense probably damaging 0.99
R2165:Cdh1 UTSW 8 106664321 missense probably damaging 1.00
R2266:Cdh1 UTSW 8 106662003 missense probably benign
R2761:Cdh1 UTSW 8 106653849 missense possibly damaging 0.90
R4547:Cdh1 UTSW 8 106663903 missense probably damaging 1.00
R5131:Cdh1 UTSW 8 106663798 missense possibly damaging 0.95
R5767:Cdh1 UTSW 8 106668555 missense probably damaging 0.97
R5931:Cdh1 UTSW 8 106666332 critical splice donor site probably null
R6254:Cdh1 UTSW 8 106663798 missense probably damaging 1.00
R6397:Cdh1 UTSW 8 106604290 missense possibly damaging 0.81
R6888:Cdh1 UTSW 8 106658314 missense probably benign 0.09
R6928:Cdh1 UTSW 8 106661010 missense possibly damaging 0.93
R6995:Cdh1 UTSW 8 106660913 missense probably benign 0.02
R7110:Cdh1 UTSW 8 106668544 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GATGTGCTAGATGAATCAGGTTCC -3'
(R):5'- AGTGCTAAGACTAGAGGCCC -3'

Sequencing Primer
(F):5'- AATCAGGTTCCCTTTCTGGAGAAG -3'
(R):5'- CCAGATTAGACAGCTCCCTG -3'
Posted On2014-10-01