Incidental Mutation 'R2163:Scn11a'
ID 235291
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 040166-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R2163 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119584091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1508 (D1508A)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: D1508A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: D1508A

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: D1508A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik C A 14: 67,175,997 (GRCm39) T64K unknown Het
Ablim2 T C 5: 35,959,697 (GRCm39) probably benign Het
Acp4 T C 7: 43,905,400 (GRCm39) D107G probably damaging Het
Adamts2 T A 11: 50,679,632 (GRCm39) C871S probably benign Het
Adamts3 A G 5: 89,856,577 (GRCm39) V332A probably damaging Het
Alkal1 C T 1: 6,459,736 (GRCm39) T104M probably benign Het
Astn1 A G 1: 158,329,720 (GRCm39) S192G probably damaging Het
Axdnd1 A C 1: 156,219,573 (GRCm39) V337G probably damaging Het
Baiap2l2 T C 15: 79,143,395 (GRCm39) D481G possibly damaging Het
Cacna2d1 C T 5: 16,567,317 (GRCm39) T964I probably damaging Het
Carf T C 1: 60,186,645 (GRCm39) probably benign Het
Catsper2 T C 2: 121,230,656 (GRCm39) D295G probably damaging Het
Cdh1 A G 8: 107,375,713 (GRCm39) T84A probably benign Het
Chd8 T A 14: 52,436,275 (GRCm39) H2508L possibly damaging Het
Chl1 A T 6: 103,688,192 (GRCm39) T284S probably damaging Het
Chtop A T 3: 90,409,518 (GRCm39) M125K probably benign Het
Col14a1 T A 15: 55,308,041 (GRCm39) probably benign Het
Cplane1 T A 15: 8,232,735 (GRCm39) probably null Het
Cyp2b10 A T 7: 25,624,810 (GRCm39) probably benign Het
Cyp2c70 G A 19: 40,149,163 (GRCm39) H328Y possibly damaging Het
Dcbld1 A G 10: 52,162,452 (GRCm39) T77A probably damaging Het
Dnah6 A T 6: 73,066,729 (GRCm39) probably null Het
Efhd1 A T 1: 87,217,195 (GRCm39) D104V probably damaging Het
Eif5b A T 1: 38,087,875 (GRCm39) D957V probably benign Het
Eps15 T A 4: 109,227,866 (GRCm39) S549R probably damaging Het
Fbxo3 C A 2: 103,885,330 (GRCm39) H400N probably benign Het
Fcer1a A G 1: 173,050,264 (GRCm39) V86A probably damaging Het
Fh1 A G 1: 175,442,406 (GRCm39) M148T possibly damaging Het
Foxc1 C A 13: 31,992,586 (GRCm39) H466N unknown Het
Gadl1 T A 9: 115,778,626 (GRCm39) I180N possibly damaging Het
Gm10801 G C 2: 98,494,352 (GRCm39) R143T possibly damaging Het
Gm21718 T C 14: 51,555,223 (GRCm39) noncoding transcript Het
Hivep2 T A 10: 14,003,970 (GRCm39) Y189* probably null Het
Hoxd13 T A 2: 74,499,413 (GRCm39) S254T possibly damaging Het
Hspd1 A G 1: 55,117,697 (GRCm39) probably benign Het
Il1r1 A G 1: 40,334,023 (GRCm39) M198V probably benign Het
Katnal1 T A 5: 148,825,746 (GRCm39) I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 (GRCm38) probably null Het
Mybpc1 T C 10: 88,376,804 (GRCm39) probably benign Het
Mycbp2 A G 14: 103,407,291 (GRCm39) probably null Het
Nell2 G T 15: 95,327,859 (GRCm39) N301K probably damaging Het
Nenf T A 1: 191,042,132 (GRCm39) D108V probably damaging Het
Nfkbiz T C 16: 55,638,581 (GRCm39) N293S probably benign Het
Nipbl T C 15: 8,366,403 (GRCm39) K1229E probably damaging Het
Nlrp4a T C 7: 26,152,822 (GRCm39) F631L probably benign Het
Nrp1 T A 8: 129,224,352 (GRCm39) V705E probably damaging Het
Nsf G C 11: 103,754,159 (GRCm39) A459G possibly damaging Het
Or1af1 A G 2: 37,110,089 (GRCm39) E196G probably damaging Het
Or5w10 A G 2: 87,375,238 (GRCm39) S217P probably damaging Het
Pdia4 C T 6: 47,775,341 (GRCm39) D490N possibly damaging Het
Pinlyp T A 7: 24,241,226 (GRCm39) Y192F probably benign Het
Pkd2 T C 5: 104,603,543 (GRCm39) probably benign Het
Ppara A G 15: 85,685,247 (GRCm39) K399E probably benign Het
Ppp4r2 C A 6: 100,842,047 (GRCm39) N169K probably damaging Het
Prom1 T A 5: 44,171,505 (GRCm39) E632V possibly damaging Het
Rpap3 T A 15: 97,578,229 (GRCm39) Y562F possibly damaging Het
Rsph14 T A 10: 74,793,611 (GRCm39) K263N probably damaging Het
Sanbr T C 11: 23,526,826 (GRCm39) probably benign Het
Scn7a T C 2: 66,506,300 (GRCm39) T1530A probably damaging Het
Sec14l1 T A 11: 117,034,108 (GRCm39) probably null Het
Slc4a4 A G 5: 89,362,435 (GRCm39) I840V probably damaging Het
Slco1a8 G A 6: 141,926,664 (GRCm39) T554I possibly damaging Het
Slco1c1 T A 6: 141,505,478 (GRCm39) V419D probably benign Het
Sltm T A 9: 70,498,964 (GRCm39) F1013I probably damaging Het
Spam1 A G 6: 24,796,846 (GRCm39) K266E probably benign Het
Syt15 A G 14: 33,948,073 (GRCm39) E306G probably benign Het
Tap1 A T 17: 34,408,447 (GRCm39) probably null Het
Tbc1d16 G C 11: 119,045,904 (GRCm39) probably benign Het
Tex47 T C 5: 7,355,022 (GRCm39) Y68H probably damaging Het
Ttn T C 2: 76,642,845 (GRCm39) T13264A probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubxn2a A T 12: 4,935,757 (GRCm39) F131Y probably damaging Het
Usp40 T C 1: 87,923,580 (GRCm39) probably benign Het
Vmn1r170 T C 7: 23,306,462 (GRCm39) L288P probably damaging Het
Vmn1r175 A G 7: 23,508,352 (GRCm39) Y92H probably benign Het
Wdpcp G T 11: 21,835,015 (GRCm39) E673* probably null Het
Zfr T A 15: 12,162,309 (GRCm39) L820I probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACAGCTATGTACATGTTAACCAC -3'
(R):5'- TCGGTCGAATCCTCAGACTG -3'

Sequencing Primer
(F):5'- GCTATGTACATGTTAACCACAATGAG -3'
(R):5'- TCGAATCCTCAGACTGGTCCG -3'
Posted On 2014-10-01