Incidental Mutation 'R2163:Ppara'
ID235315
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Nameperoxisome proliferator activated receptor alpha
SynonymsPpar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik
MMRRC Submission 040166-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2163 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85734983-85802819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85801046 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 399 (K399E)
Ref Sequence ENSEMBL: ENSMUSP00000105050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
Predicted Effect probably benign
Transcript: ENSMUST00000057979
AA Change: K399E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: K399E

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109422
AA Change: K399E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: K399E

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109423
AA Change: K399E

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: K399E

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Meta Mutation Damage Score 0.2336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,576,826 probably benign Het
2410089E03Rik T A 15: 8,203,251 probably null Het
4930578I07Rik C A 14: 66,938,548 T64K unknown Het
Ablim2 T C 5: 35,802,353 probably benign Het
Acp4 T C 7: 44,255,976 D107G probably damaging Het
Adamts2 T A 11: 50,788,805 C871S probably benign Het
Adamts3 A G 5: 89,708,718 V332A probably damaging Het
Alkal1 C T 1: 6,389,512 T104M probably benign Het
Astn1 A G 1: 158,502,150 S192G probably damaging Het
Axdnd1 A C 1: 156,392,003 V337G probably damaging Het
Baiap2l2 T C 15: 79,259,195 D481G possibly damaging Het
Cacna2d1 C T 5: 16,362,319 T964I probably damaging Het
Carf T C 1: 60,147,486 probably benign Het
Catsper2 T C 2: 121,400,175 D295G probably damaging Het
Cdh1 A G 8: 106,649,081 T84A probably benign Het
Chd8 T A 14: 52,198,818 H2508L possibly damaging Het
Chl1 A T 6: 103,711,231 T284S probably damaging Het
Chtop A T 3: 90,502,211 M125K probably benign Het
Col14a1 T A 15: 55,444,645 probably benign Het
Cyp2b10 A T 7: 25,925,385 probably benign Het
Cyp2c70 G A 19: 40,160,719 H328Y possibly damaging Het
Dcbld1 A G 10: 52,286,356 T77A probably damaging Het
Dnah6 A T 6: 73,089,746 probably null Het
Efhd1 A T 1: 87,289,473 D104V probably damaging Het
Eif5b A T 1: 38,048,794 D957V probably benign Het
Eps15 T A 4: 109,370,669 S549R probably damaging Het
Fbxo3 C A 2: 104,054,985 H400N probably benign Het
Fcer1a A G 1: 173,222,697 V86A probably damaging Het
Fh1 A G 1: 175,614,840 M148T possibly damaging Het
Foxc1 C A 13: 31,808,603 H466N unknown Het
Gadl1 T A 9: 115,949,558 I180N possibly damaging Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm21718 T C 14: 51,317,766 noncoding transcript Het
Gm6614 G A 6: 141,980,938 T554I possibly damaging Het
Hivep2 T A 10: 14,128,226 Y189* probably null Het
Hoxd13 T A 2: 74,669,069 S254T possibly damaging Het
Hspd1 A G 1: 55,078,538 probably benign Het
Il1r1 A G 1: 40,294,863 M198V probably benign Het
Katnal1 T A 5: 148,888,936 I362F probably damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Mybpc1 T C 10: 88,540,942 probably benign Het
Mycbp2 A G 14: 103,169,855 probably null Het
Nell2 G T 15: 95,429,978 N301K probably damaging Het
Nenf T A 1: 191,309,935 D108V probably damaging Het
Nfkbiz T C 16: 55,818,218 N293S probably benign Het
Nipbl T C 15: 8,336,919 K1229E probably damaging Het
Nlrp4a T C 7: 26,453,397 F631L probably benign Het
Nrp1 T A 8: 128,497,871 V705E probably damaging Het
Nsf G C 11: 103,863,333 A459G possibly damaging Het
Olfr1128 A G 2: 87,544,894 S217P probably damaging Het
Olfr366 A G 2: 37,220,077 E196G probably damaging Het
Pdia4 C T 6: 47,798,407 D490N possibly damaging Het
Pinlyp T A 7: 24,541,801 Y192F probably benign Het
Pkd2 T C 5: 104,455,677 probably benign Het
Ppp4r2 C A 6: 100,865,086 N169K probably damaging Het
Prom1 T A 5: 44,014,163 E632V possibly damaging Het
Rpap3 T A 15: 97,680,348 Y562F possibly damaging Het
Rsph14 T A 10: 74,957,779 K263N probably damaging Het
Scn11a T G 9: 119,755,025 D1508A probably damaging Het
Scn7a T C 2: 66,675,956 T1530A probably damaging Het
Sec14l1 T A 11: 117,143,282 probably null Het
Slc4a4 A G 5: 89,214,576 I840V probably damaging Het
Slco1c1 T A 6: 141,559,752 V419D probably benign Het
Sltm T A 9: 70,591,682 F1013I probably damaging Het
Spam1 A G 6: 24,796,847 K266E probably benign Het
Syt15 A G 14: 34,226,116 E306G probably benign Het
Tap1 A T 17: 34,189,473 probably null Het
Tbc1d16 G C 11: 119,155,078 probably benign Het
Tex47 T C 5: 7,305,022 Y68H probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T C 2: 76,812,501 T13264A probably damaging Het
Ubxn2a A T 12: 4,885,757 F131Y probably damaging Het
Usp40 T C 1: 87,995,858 probably benign Het
Vmn1r170 T C 7: 23,607,037 L288P probably damaging Het
Vmn1r175 A G 7: 23,808,927 Y92H probably benign Het
Wdpcp G T 11: 21,885,015 E673* probably null Het
Zfr T A 15: 12,162,223 L820I probably damaging Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85801067 missense probably benign 0.00
IGL00754:Ppara APN 15 85777642 missense probably damaging 0.99
IGL01409:Ppara APN 15 85777643 missense probably damaging 0.98
IGL02080:Ppara APN 15 85789019 missense possibly damaging 0.74
IGL02442:Ppara APN 15 85801143 missense probably benign 0.19
IGL02810:Ppara APN 15 85777677 missense probably damaging 0.99
IGL02852:Ppara APN 15 85797878 missense probably benign 0.00
R0333:Ppara UTSW 15 85790960 missense probably damaging 1.00
R0551:Ppara UTSW 15 85787105 splice site probably benign
R0883:Ppara UTSW 15 85798171 missense probably damaging 1.00
R1125:Ppara UTSW 15 85789055 missense possibly damaging 0.71
R1189:Ppara UTSW 15 85798164 missense probably benign 0.04
R1233:Ppara UTSW 15 85798021 missense probably damaging 1.00
R1582:Ppara UTSW 15 85798228 missense possibly damaging 0.69
R1755:Ppara UTSW 15 85797979 missense probably benign 0.14
R1913:Ppara UTSW 15 85801099 missense probably damaging 1.00
R4570:Ppara UTSW 15 85787197 missense probably benign 0.02
R4980:Ppara UTSW 15 85787233 missense probably damaging 0.99
R5117:Ppara UTSW 15 85777761 missense probably benign 0.00
R5749:Ppara UTSW 15 85789028 missense probably benign 0.35
R6199:Ppara UTSW 15 85787233 missense probably damaging 0.99
R6221:Ppara UTSW 15 85777680 missense probably benign 0.02
R6624:Ppara UTSW 15 85791036 missense probably benign 0.24
R7382:Ppara UTSW 15 85787228 missense probably damaging 1.00
R7534:Ppara UTSW 15 85777726 missense probably benign
R7629:Ppara UTSW 15 85798191 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGTCTGTACCCATCAGAGG -3'
(R):5'- TCTCTTGCAACAGTGGGTG -3'

Sequencing Primer
(F):5'- TACCCATCAGAGGCGGTGAC -3'
(R):5'- AACAGTGGGTGCAGCGC -3'
Posted On2014-10-01