Incidental Mutation 'R2164:Nrp2'
ID 235321
Institutional Source Beutler Lab
Gene Symbol Nrp2
Ensembl Gene ENSMUSG00000025969
Gene Name neuropilin 2
Synonyms Npn2, NP-2, NP2, Npn-2, 1110048P06Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 62703285-62818695 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62744355 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 205 (E205V)
Ref Sequence ENSEMBL: ENSMUSP00000109794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]
AlphaFold O35375
Predicted Effect probably damaging
Transcript: ENSMUST00000027112
AA Change: E205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 1.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063594
AA Change: E205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 816 831 N/A INTRINSIC
Pfam:DUF3481 839 923 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075144
AA Change: E205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 827 911 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102822
AA Change: E205V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 822 906 2.3e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114155
AA Change: E205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
Pfam:DUF3481 817 901 9.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114157
AA Change: E205V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: E205V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 28 142 3.4e-45 SMART
CUB 149 267 1.04e-40 SMART
FA58C 276 427 1.63e-45 SMART
FA58C 433 592 9.33e-14 SMART
MAM 641 802 2.31e-60 SMART
low complexity region 821 836 N/A INTRINSIC
Pfam:DUF3481 844 928 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126344
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Nrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Nrp2 APN 1 62704251 nonsense probably null
IGL01912:Nrp2 APN 1 62771737 missense probably damaging 1.00
IGL01996:Nrp2 APN 1 62749260 missense probably damaging 1.00
IGL02184:Nrp2 APN 1 62718940 nonsense probably null
IGL02682:Nrp2 APN 1 62771837 missense probably benign 0.03
IGL02928:Nrp2 APN 1 62815446 missense probably damaging 1.00
IGL03024:Nrp2 APN 1 62771734 missense probably damaging 1.00
Euphorbia UTSW 1 62762813 missense probably benign 0.02
Sabra UTSW 1 62783521 missense probably damaging 1.00
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0068:Nrp2 UTSW 1 62745377 missense possibly damaging 0.95
R0683:Nrp2 UTSW 1 62744318 missense probably benign 0.41
R0789:Nrp2 UTSW 1 62745450 missense probably benign 0.44
R1418:Nrp2 UTSW 1 62783332 nonsense probably null
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1468:Nrp2 UTSW 1 62738299 missense probably damaging 1.00
R1544:Nrp2 UTSW 1 62762904 missense probably damaging 1.00
R1645:Nrp2 UTSW 1 62785124 missense probably damaging 0.97
R1677:Nrp2 UTSW 1 62783320 missense probably benign 0.18
R1752:Nrp2 UTSW 1 62738441 missense probably damaging 1.00
R1840:Nrp2 UTSW 1 62738339 missense probably damaging 1.00
R1916:Nrp2 UTSW 1 62762747 missense probably damaging 1.00
R1962:Nrp2 UTSW 1 62718931 missense probably benign 0.03
R2108:Nrp2 UTSW 1 62744277 missense probably damaging 1.00
R2216:Nrp2 UTSW 1 62762918 nonsense probably null
R2679:Nrp2 UTSW 1 62785078 missense probably benign 0.00
R4349:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4351:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4352:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4353:Nrp2 UTSW 1 62738417 missense probably damaging 1.00
R4811:Nrp2 UTSW 1 62719081 missense probably damaging 1.00
R5362:Nrp2 UTSW 1 62769062 missense probably benign 0.01
R5387:Nrp2 UTSW 1 62762813 missense probably benign 0.02
R5461:Nrp2 UTSW 1 62747211 nonsense probably null
R5704:Nrp2 UTSW 1 62785108 missense probably benign 0.00
R6143:Nrp2 UTSW 1 62760815 missense probably damaging 1.00
R6303:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6304:Nrp2 UTSW 1 62745406 missense probably damaging 1.00
R6376:Nrp2 UTSW 1 62719017 missense possibly damaging 0.65
R6945:Nrp2 UTSW 1 62760788 missense probably damaging 1.00
R7347:Nrp2 UTSW 1 62745504 missense probably benign 0.04
R7393:Nrp2 UTSW 1 62745424 missense probably damaging 0.98
R7593:Nrp2 UTSW 1 62719044 missense probably damaging 0.96
R7881:Nrp2 UTSW 1 62771831 missense probably benign 0.42
R7882:Nrp2 UTSW 1 62783521 missense probably damaging 1.00
R7948:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7958:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7959:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7960:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R7961:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8009:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8012:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8014:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8015:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8068:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8069:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8070:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8071:Nrp2 UTSW 1 62745408 missense probably damaging 1.00
R8206:Nrp2 UTSW 1 62747215 missense probably damaging 1.00
R8791:Nrp2 UTSW 1 62749197 missense probably damaging 1.00
R9090:Nrp2 UTSW 1 62745511 missense probably benign 0.21
R9271:Nrp2 UTSW 1 62745511 missense probably benign 0.21
R9287:Nrp2 UTSW 1 62795855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTAAATAACCCAAAGGCAGAGG -3'
(R):5'- TTCAAGTCCAGTCACTTTGGC -3'

Sequencing Primer
(F):5'- CTCAGGCTCTGAAGATTGTTCCAAG -3'
(R):5'- AGAGACAGTCCTCTGGGTATATCTC -3'
Posted On 2014-10-01