Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Atf6'

235323

Institutional Source

Beutler Lab

Gene Symbol

Atf6

Ensembl Gene

ENSMUSG00000026663

Gene Name

activating transcription factor 6

Synonyms

9130025P16Rik, ESTM49, Atf6alpha

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

170704674-170867771 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 170794735 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 439 (M439T)

Ref Sequence

ENSEMBL: ENSMUSP00000027974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027974]

AlphaFold

F6VAN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027974
AA Change: M439T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: M439T

Domain	Start	End	E-Value	Type
low complexity region	78	101	N/A	INTRINSIC
low complexity region	109	121	N/A	INTRINSIC
low complexity region	168	178	N/A	INTRINSIC
BRLZ	291	355	2.72e-16	SMART
Blast:BRLZ	384	419	5e-6	BLAST
low complexity region	445	457	N/A	INTRINSIC
low complexity region	631	650	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182787

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Atf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Atf6	APN	1	170788606	critical splice donor site	probably null
IGL01431:Atf6	APN	1	170853002	splice site	probably benign
IGL01755:Atf6	APN	1	170788611	missense	possibly damaging	0.63
IGL02060:Atf6	APN	1	170819420	missense	probably damaging	0.99
IGL02416:Atf6	APN	1	170747157	nonsense	probably null
IGL02903:Atf6	APN	1	170799714	missense	probably benign	0.00
IGL02989:Atf6	APN	1	170788683	splice site	probably benign
IGL03209:Atf6	APN	1	170834894	missense	probably benign
R0455:Atf6	UTSW	1	170834923	missense	probably benign	0.00
R0467:Atf6	UTSW	1	170794020	missense	probably damaging	1.00
R0491:Atf6	UTSW	1	170787344	critical splice donor site	probably null
R0784:Atf6	UTSW	1	170709947	missense	probably benign	0.19
R1486:Atf6	UTSW	1	170794691	missense	probably damaging	1.00
R1850:Atf6	UTSW	1	170819286	missense	probably damaging	1.00
R1945:Atf6	UTSW	1	170855141	missense	probably benign	0.00
R3782:Atf6	UTSW	1	170794767	nonsense	probably null
R4454:Atf6	UTSW	1	170794039	missense	probably damaging	0.99
R4631:Atf6	UTSW	1	170747197	splice site	probably null
R4676:Atf6	UTSW	1	170787410	missense	probably damaging	1.00
R5772:Atf6	UTSW	1	170747189	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841775	missense	probably damaging	1.00
R5860:Atf6	UTSW	1	170841776	missense	possibly damaging	0.95
R5950:Atf6	UTSW	1	170834879	missense	probably damaging	1.00
R6242:Atf6	UTSW	1	170793976	missense	possibly damaging	0.46
R6520:Atf6	UTSW	1	170867669	missense	probably benign	0.00
R7032:Atf6	UTSW	1	170799612	critical splice donor site	probably null
R7472:Atf6	UTSW	1	170815491	missense	possibly damaging	0.83
R7923:Atf6	UTSW	1	170794706	missense	probably benign
R8002:Atf6	UTSW	1	170819254	missense	probably benign	0.43
R8860:Atf6	UTSW	1	170852966	missense	probably null	0.95
R8956:Atf6	UTSW	1	170794007	missense	probably damaging	0.98
R9090:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9271:Atf6	UTSW	1	170794676	missense	probably damaging	1.00
R9323:Atf6	UTSW	1	170855113	nonsense	probably null
R9500:Atf6	UTSW	1	170747139	missense	probably damaging	0.98
R9594:Atf6	UTSW	1	170840833	missense	probably benign	0.18
R9733:Atf6	UTSW	1	170834833	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCAAGTCAGATTCTCTTGGC -3'
(R):5'- AACTGAGAGAATGACAGTCCAC -3'

Sequencing Primer
(F):5'- CTTGGCCTCTTACTAAAGCTGAAG -3'
(R):5'- CTGAGAGAATGACAGTCCACCATATG -3'

Posted On

2014-10-01