Incidental Mutation 'R2164:Atf6'
ID235323
Institutional Source Beutler Lab
Gene Symbol Atf6
Ensembl Gene ENSMUSG00000026663
Gene Nameactivating transcription factor 6
Synonyms9130025P16Rik, ESTM49, Atf6alpha
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170704674-170867771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 170794735 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 439 (M439T)
Ref Sequence ENSEMBL: ENSMUSP00000027974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027974]
AlphaFold F6VAN0
Predicted Effect probably damaging
Transcript: ENSMUST00000027974
AA Change: M439T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027974
Gene: ENSMUSG00000026663
AA Change: M439T

DomainStartEndE-ValueType
low complexity region 78 101 N/A INTRINSIC
low complexity region 109 121 N/A INTRINSIC
low complexity region 168 178 N/A INTRINSIC
BRLZ 291 355 2.72e-16 SMART
Blast:BRLZ 384 419 5e-6 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 631 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182787
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that activates target genes for the unfolded protein response (UPR) during endoplasmic reticulum (ER) stress. Although it is a transcription factor, this protein is unusual in that it is synthesized as a transmembrane protein that is embedded in the ER. It functions as an ER stress sensor/transducer, and following ER stress-induced proteolysis, it functions as a nuclear transcription factor via a cis-acting ER stress response element (ERSE) that is present in the promoters of genes encoding ER chaperones. This protein has been identified as a survival factor for quiescent but not proliferative squamous carcinoma cells. There have been conflicting reports about the association of polymorphisms in this gene with diabetes in different populations, but another polymorphism has been associated with increased plasma cholesterol levels. This gene is also thought to be a potential therapeutic target for cystic fibrosis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to dithiothreitol, thapsigargin, and tunicamycin. Mice homozygous for a conditional allele activated in islet cells exhibit reduced sensitivity to TUDCA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Atf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Atf6 APN 1 170788606 critical splice donor site probably null
IGL01431:Atf6 APN 1 170853002 splice site probably benign
IGL01755:Atf6 APN 1 170788611 missense possibly damaging 0.63
IGL02060:Atf6 APN 1 170819420 missense probably damaging 0.99
IGL02416:Atf6 APN 1 170747157 nonsense probably null
IGL02903:Atf6 APN 1 170799714 missense probably benign 0.00
IGL02989:Atf6 APN 1 170788683 splice site probably benign
IGL03209:Atf6 APN 1 170834894 missense probably benign
R0455:Atf6 UTSW 1 170834923 missense probably benign 0.00
R0467:Atf6 UTSW 1 170794020 missense probably damaging 1.00
R0491:Atf6 UTSW 1 170787344 critical splice donor site probably null
R0784:Atf6 UTSW 1 170709947 missense probably benign 0.19
R1486:Atf6 UTSW 1 170794691 missense probably damaging 1.00
R1850:Atf6 UTSW 1 170819286 missense probably damaging 1.00
R1945:Atf6 UTSW 1 170855141 missense probably benign 0.00
R3782:Atf6 UTSW 1 170794767 nonsense probably null
R4454:Atf6 UTSW 1 170794039 missense probably damaging 0.99
R4631:Atf6 UTSW 1 170747197 splice site probably null
R4676:Atf6 UTSW 1 170787410 missense probably damaging 1.00
R5772:Atf6 UTSW 1 170747189 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841775 missense probably damaging 1.00
R5860:Atf6 UTSW 1 170841776 missense possibly damaging 0.95
R5950:Atf6 UTSW 1 170834879 missense probably damaging 1.00
R6242:Atf6 UTSW 1 170793976 missense possibly damaging 0.46
R6520:Atf6 UTSW 1 170867669 missense probably benign 0.00
R7032:Atf6 UTSW 1 170799612 critical splice donor site probably null
R7472:Atf6 UTSW 1 170815491 missense possibly damaging 0.83
R7923:Atf6 UTSW 1 170794706 missense probably benign
R8002:Atf6 UTSW 1 170819254 missense probably benign 0.43
R8860:Atf6 UTSW 1 170852966 missense probably null 0.95
R8956:Atf6 UTSW 1 170794007 missense probably damaging 0.98
R9090:Atf6 UTSW 1 170794676 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAGTCAGATTCTCTTGGC -3'
(R):5'- AACTGAGAGAATGACAGTCCAC -3'

Sequencing Primer
(F):5'- CTTGGCCTCTTACTAAAGCTGAAG -3'
(R):5'- CTGAGAGAATGACAGTCCACCATATG -3'
Posted On2014-10-01