Incidental Mutation 'R2164:Tomm40l'
Institutional Source Beutler Lab
Gene Symbol Tomm40l
Ensembl Gene ENSMUSG00000005674
Gene Nametranslocase of outer mitochondrial membrane 40-like
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosomal Location171216011-171222514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 171220134 bp
Amino Acid Change Serine to Asparagine at position 220 (S220N)
Ref Sequence ENSEMBL: ENSMUSP00000106959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000005824] [ENSMUST00000075469] [ENSMUST00000111319] [ENSMUST00000111320] [ENSMUST00000111321] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000147246] [ENSMUST00000155126] [ENSMUST00000143405] [ENSMUST00000133075] [ENSMUST00000138184]
Predicted Effect probably damaging
Transcript: ENSMUST00000005817
AA Change: S220N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674
AA Change: S220N

Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000005820
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005824
SMART Domains Protein: ENSMUSP00000005824
Gene: ENSMUSG00000005681

signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075469
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111319
SMART Domains Protein: ENSMUSP00000106951
Gene: ENSMUSG00000005681

signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 98 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111320
SMART Domains Protein: ENSMUSP00000106952
Gene: ENSMUSG00000005681

signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111321
SMART Domains Protein: ENSMUSP00000106953
Gene: ENSMUSG00000005681

signal peptide 1 18 N/A INTRINSIC
Pfam:ApoA-II 24 99 4.2e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111326
AA Change: S186N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674
AA Change: S186N

Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111327
AA Change: S220N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674
AA Change: S220N

Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111328
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 91 5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155126
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

HOLI 36 196 5.55e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 119 1.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Tomm40l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Tomm40l APN 1 171220309 splice site probably null
IGL01996:Tomm40l APN 1 171219655 missense possibly damaging 0.95
IGL02237:Tomm40l APN 1 171220894 missense possibly damaging 0.88
IGL02548:Tomm40l APN 1 171221647 unclassified probably benign
R1612:Tomm40l UTSW 1 171221902 critical splice donor site probably null
R2219:Tomm40l UTSW 1 171221981 nonsense probably null
R2220:Tomm40l UTSW 1 171221981 nonsense probably null
R3083:Tomm40l UTSW 1 171221211 missense probably damaging 1.00
R4748:Tomm40l UTSW 1 171219562 nonsense probably null
R4749:Tomm40l UTSW 1 171219562 nonsense probably null
R6358:Tomm40l UTSW 1 171219637 missense possibly damaging 0.77
R6457:Tomm40l UTSW 1 171220592 missense probably damaging 1.00
R8394:Tomm40l UTSW 1 171221207 missense probably damaging 0.97
X0026:Tomm40l UTSW 1 171221575 missense probably damaging 1.00
Z1176:Tomm40l UTSW 1 171220648 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-10-01