Incidental Mutation 'R2164:Vav2'
ID235326
Institutional Source Beutler Lab
Gene Symbol Vav2
Ensembl Gene ENSMUSG00000009621
Gene Namevav 2 oncogene
Synonyms2810040F13Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27262104-27427033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27273706 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 628 (D628G)
Ref Sequence ENSEMBL: ENSMUSP00000138964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056176] [ENSMUST00000185188]
AlphaFold Q60992
Predicted Effect probably benign
Transcript: ENSMUST00000056176
AA Change: D657G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000062782
Gene: ENSMUSG00000009621
AA Change: D657G

DomainStartEndE-ValueType
CH 3 115 1.87e-24 SMART
low complexity region 165 176 N/A INTRINSIC
RhoGEF 197 370 2.41e-57 SMART
PH 401 504 2.05e-10 SMART
C1 514 562 1.43e-11 SMART
SH3 579 641 1.26e-13 SMART
SH2 661 743 3.37e-25 SMART
low complexity region 759 777 N/A INTRINSIC
SH3 809 866 3.27e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149758
Predicted Effect probably damaging
Transcript: ENSMUST00000185188
AA Change: D628G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138964
Gene: ENSMUSG00000009621
AA Change: D628G

DomainStartEndE-ValueType
CH 3 129 3.71e-2 SMART
RhoGEF 163 336 2.41e-57 SMART
PH 367 475 1.78e-10 SMART
C1 485 533 1.43e-11 SMART
SH3 550 612 1.26e-13 SMART
SH2 632 714 1.26e-15 SMART
low complexity region 771 789 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Vav family of Rho guanine nucleotide exchange factors. Vav family proteins are involved in the development and activation of lymphocytes, and the encoded protein may also be involved in angiogenesis. Disruption of this gene in mice is associated with heart, artery, and kidney defects, as well as tachycardia and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have defects in humoral immune response to type II thymus-independent antigens, in primary response to thymus-dependent antigens and inability to switch immunoglobulin class, form germinal centers and generate secondary responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Vav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Vav2 APN 2 27277238 missense probably benign 0.35
IGL02394:Vav2 APN 2 27297659 splice site probably benign
IGL03088:Vav2 APN 2 27267250 missense possibly damaging 0.74
IGL03256:Vav2 APN 2 27271900 splice site probably null
IGL03295:Vav2 APN 2 27275029 missense possibly damaging 0.90
Assent UTSW 2 27296219 missense probably damaging 1.00
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0097:Vav2 UTSW 2 27299362 splice site probably benign
R0140:Vav2 UTSW 2 27273676 splice site probably benign
R0331:Vav2 UTSW 2 27296175 missense probably benign 0.09
R0619:Vav2 UTSW 2 27296121 critical splice donor site probably null
R1191:Vav2 UTSW 2 27292780 splice site probably null
R1723:Vav2 UTSW 2 27318964 missense possibly damaging 0.94
R2107:Vav2 UTSW 2 27267303 missense probably damaging 1.00
R2131:Vav2 UTSW 2 27299396 missense possibly damaging 0.71
R2268:Vav2 UTSW 2 27292655 splice site probably null
R2927:Vav2 UTSW 2 27426391 missense probably damaging 1.00
R3802:Vav2 UTSW 2 27267223 splice site probably benign
R4050:Vav2 UTSW 2 27288679 missense probably benign 0.01
R4050:Vav2 UTSW 2 27291403 missense probably damaging 1.00
R4626:Vav2 UTSW 2 27270160 missense possibly damaging 0.62
R4895:Vav2 UTSW 2 27318961 missense probably damaging 0.99
R5441:Vav2 UTSW 2 27270110 intron probably benign
R6009:Vav2 UTSW 2 27271900 splice site probably null
R6501:Vav2 UTSW 2 27296219 missense probably damaging 1.00
R6564:Vav2 UTSW 2 27279185 splice site probably null
R7206:Vav2 UTSW 2 27336719 missense probably benign 0.17
R7267:Vav2 UTSW 2 27283322 missense probably damaging 0.99
R7541:Vav2 UTSW 2 27275002 missense probably damaging 0.99
R7691:Vav2 UTSW 2 27297738 critical splice acceptor site probably null
R7786:Vav2 UTSW 2 27386601 missense probably damaging 1.00
R7822:Vav2 UTSW 2 27282287 critical splice donor site probably null
R8434:Vav2 UTSW 2 27269038 intron probably benign
R8535:Vav2 UTSW 2 27271829 missense probably damaging 1.00
R9015:Vav2 UTSW 2 27270139 nonsense probably null
R9088:Vav2 UTSW 2 27297696 missense possibly damaging 0.84
R9097:Vav2 UTSW 2 27291838 missense probably damaging 1.00
X0064:Vav2 UTSW 2 27282351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAAGCTCAATGAAGTCTGC -3'
(R):5'- CCAGGGATGTTACAGTTCAGGG -3'

Sequencing Primer
(F):5'- GTCTGCATAGAAAAGGGCTCATTACC -3'
(R):5'- GGTGCTGGGCTAAGTCCAC -3'
Posted On2014-10-01