Incidental Mutation 'R2164:Ptges'
ID 235327
Institutional Source Beutler Lab
Gene Symbol Ptges
Ensembl Gene ENSMUSG00000050737
Gene Name prostaglandin E synthase
Synonyms 2410099E23Rik, D2Ertd369e, mPGES, mPGES-1
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30889471-30929863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30892696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 115 (T115S)
Ref Sequence ENSEMBL: ENSMUSP00000099916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102852]
AlphaFold Q9JM51
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056046
SMART Domains Protein: ENSMUSP00000054679
Gene: ENSMUSG00000050737

DomainStartEndE-ValueType
Pfam:MAPEG 13 129 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102852
AA Change: T115S

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099916
Gene: ENSMUSG00000050737
AA Change: T115S

DomainStartEndE-ValueType
Pfam:MAPEG 17 147 1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132244
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and display a decreased inflammatory response. Mice homozygous for a conditional allele activated in the vascular smooth muscle, endothelial or myeloid cells exhibit altered response to vascular injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Ptges
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ptges APN 2 30892708 missense probably damaging 1.00
IGL02737:Ptges APN 2 30892686 missense probably damaging 1.00
R0352:Ptges UTSW 2 30903132 nonsense probably null
R2496:Ptges UTSW 2 30892710 missense possibly damaging 0.89
R2497:Ptges UTSW 2 30892710 missense possibly damaging 0.89
R4832:Ptges UTSW 2 30903220 utr 5 prime probably benign
R6703:Ptges UTSW 2 30903121 missense possibly damaging 0.80
R7155:Ptges UTSW 2 30892804 missense probably benign 0.07
R7601:Ptges UTSW 2 30892797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACATGTGCACATTGGGC -3'
(R):5'- GTGTGGTCTCAGCACTAAGC -3'

Sequencing Primer
(F):5'- CGCAAGTTCAGCCTTCATGG -3'
(R):5'- TAAGCCTGCTAACTATAACCCTCTG -3'
Posted On 2014-10-01