Incidental Mutation 'R2164:Fmn1'
ID 235328
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Name formin 1
Synonyms formin-1, Fmn
MMRRC Submission 040167-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.249) question?
Stock # R2164 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 113158081-113547112 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113195962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 554 (N554S)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
AlphaFold Q05860
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: N554S
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: N554S

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: N554S
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: N554S

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110954
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: N554S
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: N554S

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,101,019 (GRCm39) probably null Het
Adcy8 C T 15: 64,792,783 (GRCm39) G58S probably benign Het
Adgra2 T A 8: 27,604,232 (GRCm39) L24* probably null Het
Ampd2 C A 3: 107,992,685 (GRCm39) probably benign Het
Ankrd26 T G 6: 118,502,752 (GRCm39) E806A probably damaging Het
Apol9b A G 15: 77,619,639 (GRCm39) D145G probably benign Het
Ash1l T A 3: 88,892,726 (GRCm39) M1535K probably benign Het
Atf6 A G 1: 170,622,304 (GRCm39) M439T probably damaging Het
B3glct A T 5: 149,677,621 (GRCm39) M417L probably damaging Het
Cep192 A T 18: 67,953,431 (GRCm39) T483S probably damaging Het
Cep290 G A 10: 100,354,657 (GRCm39) E914K probably damaging Het
Chst15 C T 7: 131,872,114 (GRCm39) A56T probably damaging Het
Col27a1 A T 4: 63,143,661 (GRCm39) T450S probably benign Het
Cpsf2 A G 12: 101,951,594 (GRCm39) N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Ctc1 C T 11: 68,926,441 (GRCm39) A859V possibly damaging Het
Dcakd A G 11: 102,888,183 (GRCm39) Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 (GRCm39) Y22* probably null Het
Dync2h1 T A 9: 7,124,797 (GRCm39) D2025V probably damaging Het
Dync2li1 T C 17: 84,943,702 (GRCm39) S92P probably damaging Het
Eml5 A G 12: 98,853,356 (GRCm39) V81A probably damaging Het
Espl1 C T 15: 102,228,023 (GRCm39) R1625C probably damaging Het
Fam181a T C 12: 103,282,785 (GRCm39) V230A probably benign Het
Fanci T A 7: 79,045,743 (GRCm39) D28E probably benign Het
Frem2 T C 3: 53,444,751 (GRCm39) Y2460C probably damaging Het
Fscb G A 12: 64,520,567 (GRCm39) P300S probably damaging Het
Gm28042 A G 2: 119,867,229 (GRCm39) D438G probably benign Het
Ldaf1 A G 7: 119,719,462 (GRCm39) E157G possibly damaging Het
Map1b C T 13: 99,565,846 (GRCm39) V2292M unknown Het
Nbas A G 12: 13,380,647 (GRCm39) D635G possibly damaging Het
Ncapg2 A G 12: 116,414,095 (GRCm39) probably null Het
Nrp2 A T 1: 62,783,514 (GRCm39) E205V probably damaging Het
Pcdhb3 A T 18: 37,435,239 (GRCm39) T402S possibly damaging Het
Phc1 T C 6: 122,299,296 (GRCm39) N638D possibly damaging Het
Plcb1 A G 2: 135,188,250 (GRCm39) N781S possibly damaging Het
Prkdc T A 16: 15,523,071 (GRCm39) D1164E probably damaging Het
Proser2 T A 2: 6,105,506 (GRCm39) R353W possibly damaging Het
Prxl2b T G 4: 154,982,606 (GRCm39) Y56S probably damaging Het
Ptges T A 2: 30,782,708 (GRCm39) T115S probably benign Het
Ptprk A T 10: 28,436,138 (GRCm39) D833V probably damaging Het
Pum1 T A 4: 130,455,394 (GRCm39) L173* probably null Het
Pum1 G T 4: 130,455,395 (GRCm39) L269F probably damaging Het
Rasgrp4 A G 7: 28,838,470 (GRCm39) Y106C probably damaging Het
Rbbp6 T A 7: 122,598,697 (GRCm39) probably benign Het
Rdh1 A G 10: 127,596,041 (GRCm39) T79A possibly damaging Het
Relb A C 7: 19,347,686 (GRCm39) probably null Het
Rnf122 G A 8: 31,602,192 (GRCm39) W6* probably null Het
Rnf31 A G 14: 55,829,994 (GRCm39) E138G possibly damaging Het
Scaf8 G A 17: 3,247,485 (GRCm39) R936Q probably damaging Het
Scube3 T A 17: 28,385,108 (GRCm39) V686D possibly damaging Het
Snrnp27 A T 6: 86,653,196 (GRCm39) C141S probably benign Het
Spns2 C T 11: 72,349,497 (GRCm39) V252M possibly damaging Het
Tomm40l C T 1: 171,047,703 (GRCm39) S220N probably damaging Het
Trim17 A G 11: 58,862,237 (GRCm39) D423G probably damaging Het
Trpc6 A AT 9: 8,610,466 (GRCm39) probably null Het
Tut4 G A 4: 108,360,226 (GRCm39) R481Q possibly damaging Het
Uba5 A T 9: 103,937,442 (GRCm39) M89K probably damaging Het
Vav2 T C 2: 27,163,718 (GRCm39) D628G probably damaging Het
Vmn2r107 T C 17: 20,595,904 (GRCm39) L819P probably damaging Het
Vmn2r25 A T 6: 123,816,518 (GRCm39) D354E possibly damaging Het
Xrn1 A G 9: 95,888,873 (GRCm39) E984G possibly damaging Het
Zbtb17 T C 4: 141,191,557 (GRCm39) V223A probably benign Het
Zfp592 T C 7: 80,691,186 (GRCm39) S1122P possibly damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113,274,812 (GRCm39) intron probably benign
IGL01520:Fmn1 APN 2 113,274,713 (GRCm39) intron probably benign
IGL02039:Fmn1 APN 2 113,195,425 (GRCm39) missense unknown
IGL02222:Fmn1 APN 2 113,423,454 (GRCm39) missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113,412,470 (GRCm39) missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113,194,471 (GRCm39) missense unknown
IGL02490:Fmn1 APN 2 113,359,817 (GRCm39) splice site probably benign
IGL02506:Fmn1 APN 2 113,355,640 (GRCm39) missense unknown
IGL02684:Fmn1 APN 2 113,355,622 (GRCm39) missense unknown
IGL03008:Fmn1 APN 2 113,195,445 (GRCm39) missense unknown
IGL03058:Fmn1 APN 2 113,272,159 (GRCm39) intron probably benign
IGL03076:Fmn1 APN 2 113,414,437 (GRCm39) missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113,356,128 (GRCm39) small insertion probably benign
FR4304:Fmn1 UTSW 2 113,356,119 (GRCm39) small insertion probably benign
FR4342:Fmn1 UTSW 2 113,356,128 (GRCm39) small insertion probably benign
FR4589:Fmn1 UTSW 2 113,356,119 (GRCm39) small insertion probably benign
FR4589:Fmn1 UTSW 2 113,356,118 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,129 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,126 (GRCm39) small insertion probably benign
FR4737:Fmn1 UTSW 2 113,356,123 (GRCm39) small insertion probably benign
R0349:Fmn1 UTSW 2 113,196,141 (GRCm39) missense unknown
R0452:Fmn1 UTSW 2 113,467,124 (GRCm39) missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113,538,198 (GRCm39) splice site probably benign
R1215:Fmn1 UTSW 2 113,523,375 (GRCm39) nonsense probably null
R1471:Fmn1 UTSW 2 113,523,439 (GRCm39) missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113,195,557 (GRCm39) missense unknown
R1491:Fmn1 UTSW 2 113,426,714 (GRCm39) missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113,356,207 (GRCm39) missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113,523,463 (GRCm39) missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113,196,043 (GRCm39) missense unknown
R1602:Fmn1 UTSW 2 113,355,968 (GRCm39) missense unknown
R1690:Fmn1 UTSW 2 113,355,827 (GRCm39) missense unknown
R1772:Fmn1 UTSW 2 113,195,700 (GRCm39) missense unknown
R1867:Fmn1 UTSW 2 113,539,783 (GRCm39) missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113,260,066 (GRCm39) intron probably benign
R1941:Fmn1 UTSW 2 113,195,488 (GRCm39) missense unknown
R2019:Fmn1 UTSW 2 113,194,825 (GRCm39) missense unknown
R2140:Fmn1 UTSW 2 113,425,393 (GRCm39) missense probably benign 0.45
R2395:Fmn1 UTSW 2 113,195,526 (GRCm39) missense unknown
R2999:Fmn1 UTSW 2 113,195,439 (GRCm39) missense unknown
R3405:Fmn1 UTSW 2 113,194,693 (GRCm39) missense unknown
R3407:Fmn1 UTSW 2 113,195,400 (GRCm39) missense unknown
R3771:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113,412,463 (GRCm39) missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113,195,467 (GRCm39) missense unknown
R4166:Fmn1 UTSW 2 113,467,080 (GRCm39) missense probably benign 0.33
R4477:Fmn1 UTSW 2 113,274,744 (GRCm39) intron probably benign
R4614:Fmn1 UTSW 2 113,195,494 (GRCm39) missense unknown
R4701:Fmn1 UTSW 2 113,414,416 (GRCm39) missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113,414,465 (GRCm39) critical splice donor site probably null
R5063:Fmn1 UTSW 2 113,195,266 (GRCm39) missense unknown
R5224:Fmn1 UTSW 2 113,195,470 (GRCm39) missense unknown
R5510:Fmn1 UTSW 2 113,426,714 (GRCm39) missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113,194,648 (GRCm39) missense unknown
R6234:Fmn1 UTSW 2 113,196,000 (GRCm39) missense unknown
R6266:Fmn1 UTSW 2 113,426,683 (GRCm39) missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113,355,560 (GRCm39) missense unknown
R7054:Fmn1 UTSW 2 113,195,353 (GRCm39) missense unknown
R7311:Fmn1 UTSW 2 113,356,025 (GRCm39) missense unknown
R7439:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7440:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7441:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7444:Fmn1 UTSW 2 113,271,956 (GRCm39) missense unknown
R7461:Fmn1 UTSW 2 113,194,416 (GRCm39) missense unknown
R7526:Fmn1 UTSW 2 113,518,479 (GRCm39) missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113,359,655 (GRCm39) splice site probably null
R7576:Fmn1 UTSW 2 113,195,353 (GRCm39) missense unknown
R7657:Fmn1 UTSW 2 113,355,538 (GRCm39) missense unknown
R7669:Fmn1 UTSW 2 113,195,822 (GRCm39) missense unknown
R7713:Fmn1 UTSW 2 113,356,159 (GRCm39) missense unknown
R7841:Fmn1 UTSW 2 113,359,810 (GRCm39) critical splice donor site probably null
R7953:Fmn1 UTSW 2 113,426,689 (GRCm39) missense probably benign 0.03
R7959:Fmn1 UTSW 2 113,195,967 (GRCm39) missense unknown
R8041:Fmn1 UTSW 2 113,194,939 (GRCm39) missense unknown
R8152:Fmn1 UTSW 2 113,196,037 (GRCm39) missense unknown
R8203:Fmn1 UTSW 2 113,355,620 (GRCm39) missense unknown
R8318:Fmn1 UTSW 2 113,195,502 (GRCm39) missense unknown
R8356:Fmn1 UTSW 2 113,195,385 (GRCm39) missense unknown
R8456:Fmn1 UTSW 2 113,195,385 (GRCm39) missense unknown
R8698:Fmn1 UTSW 2 113,260,152 (GRCm39) missense unknown
R8861:Fmn1 UTSW 2 113,195,149 (GRCm39) missense unknown
R8907:Fmn1 UTSW 2 113,355,914 (GRCm39) missense unknown
R9147:Fmn1 UTSW 2 113,271,973 (GRCm39) missense unknown
R9148:Fmn1 UTSW 2 113,271,973 (GRCm39) missense unknown
R9536:Fmn1 UTSW 2 113,309,262 (GRCm39) missense unknown
R9574:Fmn1 UTSW 2 113,425,402 (GRCm39) missense probably damaging 1.00
R9577:Fmn1 UTSW 2 113,194,470 (GRCm39) missense unknown
RF003:Fmn1 UTSW 2 113,356,131 (GRCm39) small insertion probably benign
Z1088:Fmn1 UTSW 2 113,272,270 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTCCAACAGCTCTTGGC -3'
(R):5'- AGCTTAAAGAGAGACTAACCTGGTG -3'

Sequencing Primer
(F):5'- GGCATGGTATTTAATAATTCATCGCC -3'
(R):5'- ACTAACCTGGTGGCAACTG -3'
Posted On 2014-10-01