Incidental Mutation 'R2164:Frem2'
ID235331
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53537330 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2460 (Y2460C)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: Y2460C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: Y2460C

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197519
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7922:Frem2 UTSW 3 53653304 missense probably damaging 0.98
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
R8176:Frem2 UTSW 3 53655340 missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53656507 nonsense probably null
R8397:Frem2 UTSW 3 53653141 missense probably benign 0.00
R8410:Frem2 UTSW 3 53539177 missense possibly damaging 0.60
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGAAATGAGGCATTCGCAATAC -3'
(R):5'- GTGGGCCTAACACACATCTG -3'

Sequencing Primer
(F):5'- CAATACTGCAGGGTTTCAGTGACC -3'
(R):5'- GTGGGCCTAACACACATCTGTTTTG -3'
Posted On2014-10-01