Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Dctn3'

235334

Institutional Source

Beutler Lab

Gene Symbol

Dctn3

Ensembl Gene

ENSMUSG00000028447

Gene Name

dynactin 3

Synonyms

p24

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41714798-41723170 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 41723065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 22 (Y22*)

Ref Sequence

ENSEMBL: ENSMUSP00000130988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000084698] [ENSMUST00000108041] [ENSMUST00000150809] [ENSMUST00000171251] [ENSMUST00000171641]

AlphaFold

Q9Z0Y1

Predicted Effect

probably null
Transcript: ENSMUST00000030158
AA Change: Y22*

SMART Domains

Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447
AA Change: Y22*

Domain	Start	End	E-Value	Type
Pfam:Dynactin_p22	6	170	2.8e-61	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000084698

SMART Domains

Protein: ENSMUSP00000081748
Gene: ENSMUSG00000066224

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	18	32	N/A	INTRINSIC
low complexity region	41	71	N/A	INTRINSIC
ARID	107	198	5.47e-35	SMART
BRIGHT	111	203	3.7e-39	SMART
low complexity region	235	257	N/A	INTRINSIC
Blast:ARID	283	327	2e-12	BLAST
low complexity region	387	409	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108041

SMART Domains

Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	33	108	5.75e-4	SMART
FN3	112	204	2.18e-2	SMART
FN3	218	304	4.93e-1	SMART
low complexity region	354	365	N/A	INTRINSIC
transmembrane domain	369	391	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147120

Predicted Effect

probably null
Transcript: ENSMUST00000150809

SMART Domains

Protein: ENSMUSP00000116411
Gene: ENSMUSG00000066224

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	18	32	N/A	INTRINSIC
low complexity region	41	71	N/A	INTRINSIC
ARID	107	198	5.47e-35	SMART
BRIGHT	111	203	3.7e-39	SMART
low complexity region	235	257	N/A	INTRINSIC
Blast:ARID	283	327	2e-12	BLAST
low complexity region	357	379	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171251

SMART Domains

Protein: ENSMUSP00000127678
Gene: ENSMUSG00000066224

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	18	32	N/A	INTRINSIC
low complexity region	41	71	N/A	INTRINSIC
ARID	107	198	5.47e-35	SMART
BRIGHT	111	203	3.7e-39	SMART
low complexity region	235	257	N/A	INTRINSIC
Blast:ARID	283	327	2e-12	BLAST
low complexity region	387	409	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000171641
AA Change: Y22*

SMART Domains

Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447
AA Change: Y22*

Domain	Start	End	E-Value	Type
Pfam:Dynactin_p22	1	149	1.4e-63	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Dctn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Dctn3	APN	4	41719854	nonsense	probably null
IGL03000:Dctn3	APN	4	41719912	missense	possibly damaging	0.94
R1687:Dctn3	UTSW	4	41715407	missense	probably damaging	1.00
R1835:Dctn3	UTSW	4	41720813	missense	probably damaging	1.00
R3427:Dctn3	UTSW	4	41719858	missense	probably damaging	1.00
R4801:Dctn3	UTSW	4	41719904	nonsense	probably null
R4802:Dctn3	UTSW	4	41719904	nonsense	probably null
R5617:Dctn3	UTSW	4	41716407	missense	possibly damaging	0.70
R5979:Dctn3	UTSW	4	41715393	splice site	probably null
R6545:Dctn3	UTSW	4	41723084	missense	probably damaging	0.97
R6819:Dctn3	UTSW	4	41715259	missense	possibly damaging	0.79
R8951:Dctn3	UTSW	4	41719845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGGGTCCGATTGGTACC -3'
(R):5'- GGTTATTTCCGACATCCAAAGCC -3'

Sequencing Primer
(F):5'- TCCGATTGGTACCAGGAGG -3'
(R):5'- AGCCTAAACAGTGACGTCAC -3'

Posted On

2014-10-01