Incidental Mutation 'R2164:Dctn3'
ID235334
Institutional Source Beutler Lab
Gene Symbol Dctn3
Ensembl Gene ENSMUSG00000028447
Gene Namedynactin 3
Synonymsp24
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41714798-41723170 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 41723065 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 22 (Y22*)
Ref Sequence ENSEMBL: ENSMUSP00000130988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000084698] [ENSMUST00000108041] [ENSMUST00000150809] [ENSMUST00000171251] [ENSMUST00000171641]
Predicted Effect probably null
Transcript: ENSMUST00000030158
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447
AA Change: Y22*

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000084698
SMART Domains Protein: ENSMUSP00000081748
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147120
Predicted Effect probably null
Transcript: ENSMUST00000150809
SMART Domains Protein: ENSMUSP00000116411
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 357 379 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171251
SMART Domains Protein: ENSMUSP00000127678
Gene: ENSMUSG00000066224

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
low complexity region 41 71 N/A INTRINSIC
ARID 107 198 5.47e-35 SMART
BRIGHT 111 203 3.7e-39 SMART
low complexity region 235 257 N/A INTRINSIC
Blast:ARID 283 327 2e-12 BLAST
low complexity region 387 409 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171641
AA Change: Y22*
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447
AA Change: Y22*

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Dctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Dctn3 APN 4 41719854 nonsense probably null
IGL03000:Dctn3 APN 4 41719912 missense possibly damaging 0.94
R1687:Dctn3 UTSW 4 41715407 missense probably damaging 1.00
R1835:Dctn3 UTSW 4 41720813 missense probably damaging 1.00
R3427:Dctn3 UTSW 4 41719858 missense probably damaging 1.00
R4801:Dctn3 UTSW 4 41719904 nonsense probably null
R4802:Dctn3 UTSW 4 41719904 nonsense probably null
R5617:Dctn3 UTSW 4 41716407 missense possibly damaging 0.70
R5979:Dctn3 UTSW 4 41715393 splice site probably null
R6545:Dctn3 UTSW 4 41723084 missense probably damaging 0.97
R6819:Dctn3 UTSW 4 41715259 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCAAGGGTCCGATTGGTACC -3'
(R):5'- GGTTATTTCCGACATCCAAAGCC -3'

Sequencing Primer
(F):5'- TCCGATTGGTACCAGGAGG -3'
(R):5'- AGCCTAAACAGTGACGTCAC -3'
Posted On2014-10-01