Incidental Mutation 'R2164:Zcchc11'
ID235336
Institutional Source Beutler Lab
Gene Symbol Zcchc11
Ensembl Gene ENSMUSG00000034610
Gene Namezinc finger, CCHC domain containing 11
Synonyms6030404K05Rik, 9230115F04Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108459426-108559421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108503029 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 481 (R481Q)
Ref Sequence ENSEMBL: ENSMUSP00000095538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043368] [ENSMUST00000097925] [ENSMUST00000155068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043368
AA Change: R481Q

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044836
Gene: ENSMUSG00000034610
AA Change: R481Q

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 1.2e-13 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 995 1085 4.2e-10 PFAM
Pfam:PAP_assoc 1201 1254 4.7e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1359 1375 3.44e-4 SMART
low complexity region 1398 1412 N/A INTRINSIC
low complexity region 1418 1473 N/A INTRINSIC
low complexity region 1628 1639 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083365
Predicted Effect possibly damaging
Transcript: ENSMUST00000097925
AA Change: R481Q

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095538
Gene: ENSMUSG00000034610
AA Change: R481Q

DomainStartEndE-ValueType
low complexity region 260 275 N/A INTRINSIC
SCOP:d1f5aa2 363 569 2e-23 SMART
Pfam:PAP_assoc 648 701 8e-14 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 815 828 N/A INTRINSIC
ZnF_C2HC 931 947 7.79e-3 SMART
Pfam:NTP_transf_2 994 1082 6.3e-11 PFAM
Pfam:PAP_assoc 1201 1254 5.2e-19 PFAM
ZnF_C2HC 1311 1327 3.83e-3 SMART
ZnF_C2HC 1364 1380 3.44e-4 SMART
low complexity region 1403 1417 N/A INTRINSIC
low complexity region 1423 1478 N/A INTRINSIC
low complexity region 1632 1643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155068
AA Change: R442Q

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120172
Gene: ENSMUSG00000034610
AA Change: R442Q

DomainStartEndE-ValueType
low complexity region 221 236 N/A INTRINSIC
SCOP:d1f5aa2 324 530 2e-23 SMART
Pfam:PAP_assoc 609 662 8.8e-15 PFAM
low complexity region 704 719 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
ZnF_C2HC 892 908 7.79e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial postnatal lethality associated with postnatal growth retardation and reduced circulating insulin-like growth factor I levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Zcchc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zcchc11 APN 4 108550728 missense probably damaging 1.00
IGL00684:Zcchc11 APN 4 108479466 missense possibly damaging 0.80
IGL01598:Zcchc11 APN 4 108550820 unclassified probably benign
IGL01599:Zcchc11 APN 4 108513399 missense possibly damaging 0.85
IGL02088:Zcchc11 APN 4 108512218 splice site probably benign
IGL02451:Zcchc11 APN 4 108529276 nonsense probably null
IGL02667:Zcchc11 APN 4 108558708 splice site probably benign
IGL03080:Zcchc11 APN 4 108505824 missense probably damaging 1.00
IGL03374:Zcchc11 APN 4 108558777 missense probably damaging 1.00
H8786:Zcchc11 UTSW 4 108550815 critical splice donor site probably null
IGL02799:Zcchc11 UTSW 4 108513528 missense probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0013:Zcchc11 UTSW 4 108530955 splice site probably benign
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0051:Zcchc11 UTSW 4 108527004 missense probably damaging 1.00
R0410:Zcchc11 UTSW 4 108486555 missense probably benign 0.27
R0698:Zcchc11 UTSW 4 108555533 missense probably benign 0.22
R0745:Zcchc11 UTSW 4 108502955 splice site probably benign
R1080:Zcchc11 UTSW 4 108479499 missense possibly damaging 0.82
R1774:Zcchc11 UTSW 4 108507955 missense probably damaging 1.00
R1809:Zcchc11 UTSW 4 108549355 missense probably damaging 1.00
R1869:Zcchc11 UTSW 4 108529300 missense probably damaging 1.00
R1874:Zcchc11 UTSW 4 108550725 missense probably damaging 1.00
R1958:Zcchc11 UTSW 4 108555706 missense probably damaging 1.00
R1976:Zcchc11 UTSW 4 108479523 missense probably benign 0.01
R2034:Zcchc11 UTSW 4 108512195 missense probably damaging 1.00
R2251:Zcchc11 UTSW 4 108520208 missense probably damaging 1.00
R3001:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3002:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R3003:Zcchc11 UTSW 4 108512928 missense probably damaging 1.00
R4170:Zcchc11 UTSW 4 108548059 missense probably damaging 1.00
R4667:Zcchc11 UTSW 4 108495159 missense probably damaging 1.00
R4868:Zcchc11 UTSW 4 108549220 splice site probably benign
R4989:Zcchc11 UTSW 4 108526845 unclassified probably benign
R5014:Zcchc11 UTSW 4 108526846 unclassified probably benign
R5118:Zcchc11 UTSW 4 108520292 missense possibly damaging 0.92
R5431:Zcchc11 UTSW 4 108491412 missense probably damaging 1.00
R5645:Zcchc11 UTSW 4 108557373 missense probably damaging 1.00
R5661:Zcchc11 UTSW 4 108513187 missense probably benign 0.05
R5877:Zcchc11 UTSW 4 108512923 missense probably damaging 0.99
R6307:Zcchc11 UTSW 4 108555620 missense probably damaging 1.00
R6326:Zcchc11 UTSW 4 108478980 missense probably benign 0.02
R6407:Zcchc11 UTSW 4 108558782 missense probably damaging 1.00
R6493:Zcchc11 UTSW 4 108526805 missense probably damaging 1.00
R6587:Zcchc11 UTSW 4 108479449 missense probably benign
R7215:Zcchc11 UTSW 4 108527008 missense probably damaging 1.00
R7413:Zcchc11 UTSW 4 108549336 missense possibly damaging 0.69
R7584:Zcchc11 UTSW 4 108479346 missense probably benign 0.00
R7872:Zcchc11 UTSW 4 108517518 missense probably damaging 1.00
R7970:Zcchc11 UTSW 4 108486454 missense probably benign 0.00
R8214:Zcchc11 UTSW 4 108512150 missense probably benign 0.00
R8297:Zcchc11 UTSW 4 108479708 missense possibly damaging 0.86
R8504:Zcchc11 UTSW 4 108530942 missense probably damaging 1.00
R8514:Zcchc11 UTSW 4 108557357 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GGCATATAACAAATGACTCCAGG -3'
(R):5'- TTCACAAACATGGACAGATACAGTC -3'

Sequencing Primer
(F):5'- CCAGGAGAGGTAAGAGATTCTTTTG -3'
(R):5'- CAACATTTTAGATAAGCTGGCTGCCC -3'
Posted On2014-10-01