Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Pum1'

235339

Institutional Source

Beutler Lab

Gene Symbol

Pum1

Ensembl Gene

ENSMUSG00000028580

Gene Name

pumilio RNA-binding family member 1

Synonyms

Pumm

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.869) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

130663321-130781564 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 130728084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 269 (L269F)

Ref Sequence

ENSEMBL: ENSMUSP00000095476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]

AlphaFold

Q80U78

Predicted Effect

probably damaging
Transcript: ENSMUST00000030315
AA Change: L269F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: L269F

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	443	458	N/A	INTRINSIC
low complexity region	476	503	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	584	615	N/A	INTRINSIC
low complexity region	627	637	N/A	INTRINSIC
low complexity region	643	666	N/A	INTRINSIC
low complexity region	672	696	N/A	INTRINSIC
low complexity region	731	741	N/A	INTRINSIC
low complexity region	763	783	N/A	INTRINSIC
low complexity region	798	816	N/A	INTRINSIC
Pumilio	849	884	1.75e-6	SMART
Pumilio	885	920	4.03e-6	SMART
Pumilio	921	955	5.24e-5	SMART
Pumilio	959	994	3.37e-8	SMART
Pumilio	995	1030	6.29e-8	SMART
Pumilio	1031	1066	1.04e-8	SMART
Pumilio	1067	1102	6.2e-7	SMART
Pumilio	1110	1145	8.77e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097862
AA Change: L269F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: L269F

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	442	457	N/A	INTRINSIC
low complexity region	475	502	N/A	INTRINSIC
low complexity region	527	538	N/A	INTRINSIC
low complexity region	583	614	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	642	665	N/A	INTRINSIC
low complexity region	671	695	N/A	INTRINSIC
low complexity region	730	740	N/A	INTRINSIC
low complexity region	762	782	N/A	INTRINSIC
low complexity region	797	815	N/A	INTRINSIC
Pumilio	848	883	1.75e-6	SMART
Pumilio	884	919	4.03e-6	SMART
Pumilio	920	954	5.24e-5	SMART
Pumilio	958	993	3.37e-8	SMART
Pumilio	994	1029	6.29e-8	SMART
Pumilio	1030	1065	1.04e-8	SMART
Pumilio	1066	1101	6.2e-7	SMART
Pumilio	1109	1144	8.77e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097864
AA Change: L269F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: L269F

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	393	414	N/A	INTRINSIC
low complexity region	442	457	N/A	INTRINSIC
low complexity region	475	502	N/A	INTRINSIC
low complexity region	527	538	N/A	INTRINSIC
low complexity region	583	614	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	642	665	N/A	INTRINSIC
low complexity region	671	695	N/A	INTRINSIC
low complexity region	730	740	N/A	INTRINSIC
low complexity region	762	782	N/A	INTRINSIC
low complexity region	797	815	N/A	INTRINSIC
Pumilio	848	883	1.75e-6	SMART
Pumilio	884	919	4.03e-6	SMART
Pumilio	920	955	5.48e-8	SMART
Pumilio	956	991	3.37e-8	SMART
Pumilio	992	1027	6.29e-8	SMART
Pumilio	1028	1063	1.04e-8	SMART
Pumilio	1064	1099	6.2e-7	SMART
Pumilio	1107	1142	8.77e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105991

SMART Domains

Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	151	172	N/A	INTRINSIC
low complexity region	200	215	N/A	INTRINSIC
low complexity region	233	260	N/A	INTRINSIC
low complexity region	285	296	N/A	INTRINSIC
low complexity region	341	372	N/A	INTRINSIC
low complexity region	384	394	N/A	INTRINSIC
low complexity region	400	423	N/A	INTRINSIC
low complexity region	429	453	N/A	INTRINSIC
low complexity region	488	498	N/A	INTRINSIC
low complexity region	520	540	N/A	INTRINSIC
low complexity region	555	573	N/A	INTRINSIC
Pumilio	606	641	1.75e-6	SMART
Pumilio	642	677	4.03e-6	SMART
Pumilio	678	713	5.48e-8	SMART
Pumilio	714	749	3.37e-8	SMART
Pumilio	750	785	6.29e-8	SMART
Pumilio	786	821	1.04e-8	SMART
Pumilio	822	857	6.2e-7	SMART
Pumilio	865	900	8.77e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000105992
AA Change: L173F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: L173F

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	297	318	N/A	INTRINSIC
low complexity region	346	361	N/A	INTRINSIC
low complexity region	379	406	N/A	INTRINSIC
low complexity region	431	442	N/A	INTRINSIC
low complexity region	487	518	N/A	INTRINSIC
low complexity region	530	540	N/A	INTRINSIC
low complexity region	546	569	N/A	INTRINSIC
low complexity region	575	599	N/A	INTRINSIC
low complexity region	634	644	N/A	INTRINSIC
low complexity region	666	686	N/A	INTRINSIC
low complexity region	701	719	N/A	INTRINSIC
Pumilio	752	787	1.75e-6	SMART
Pumilio	788	823	4.03e-6	SMART
Pumilio	824	858	5.24e-5	SMART
Pumilio	862	897	3.37e-8	SMART
Pumilio	898	933	6.29e-8	SMART
Pumilio	934	969	1.04e-8	SMART
Pumilio	970	1005	6.2e-7	SMART
Pumilio	1013	1048	8.77e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143277

SMART Domains

Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
low complexity region	94	102	N/A	INTRINSIC
low complexity region	151	172	N/A	INTRINSIC
low complexity region	200	215	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Pum1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Pum1	APN	4	130743789	missense	probably damaging	1.00
IGL01327:Pum1	APN	4	130730543	missense	probably damaging	0.97
IGL01360:Pum1	APN	4	130728170	intron	probably benign
IGL02055:Pum1	APN	4	130754054	missense	probably benign	0.19
IGL02713:Pum1	APN	4	130766012	missense	probably damaging	1.00
IGL03401:Pum1	APN	4	130743681	splice site	probably benign
LCD18:Pum1	UTSW	4	130730549	intron	probably benign
R0077:Pum1	UTSW	4	130772674	missense	probably benign	0.06
R0346:Pum1	UTSW	4	130779805	missense	possibly damaging	0.74
R0632:Pum1	UTSW	4	130728104	missense	probably benign	0.34
R0870:Pum1	UTSW	4	130768844	missense	probably damaging	0.99
R1006:Pum1	UTSW	4	130771888	missense	probably damaging	0.98
R1300:Pum1	UTSW	4	130765961	missense	probably damaging	1.00
R1499:Pum1	UTSW	4	130719256	missense	probably damaging	1.00
R1572:Pum1	UTSW	4	130718204	missense	probably damaging	0.99
R1835:Pum1	UTSW	4	130701048	missense	possibly damaging	0.93
R1864:Pum1	UTSW	4	130751525	missense	possibly damaging	0.90
R1991:Pum1	UTSW	4	130718218	missense	possibly damaging	0.93
R2068:Pum1	UTSW	4	130774434	missense	probably benign	0.02
R2119:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2120:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2122:Pum1	UTSW	4	130669270	missense	possibly damaging	0.92
R2153:Pum1	UTSW	4	130751491	missense	probably damaging	1.00
R2164:Pum1	UTSW	4	130728083	nonsense	probably null
R2280:Pum1	UTSW	4	130766011	missense	probably damaging	1.00
R3116:Pum1	UTSW	4	130772660	missense	probably damaging	1.00
R3890:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R3891:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R3892:Pum1	UTSW	4	130764082	missense	probably damaging	1.00
R4134:Pum1	UTSW	4	130764069	missense	probably damaging	1.00
R4258:Pum1	UTSW	4	130730280	missense	probably damaging	1.00
R4731:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4732:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4733:Pum1	UTSW	4	130718193	missense	probably benign	0.00
R4973:Pum1	UTSW	4	130669137	missense	probably benign	0.27
R5198:Pum1	UTSW	4	130779879	nonsense	probably null
R5249:Pum1	UTSW	4	130762814	missense	probably benign	0.07
R5478:Pum1	UTSW	4	130751484	missense	possibly damaging	0.93
R5652:Pum1	UTSW	4	130764127	missense	possibly damaging	0.95
R5932:Pum1	UTSW	4	130730366	missense	probably benign	0.04
R6008:Pum1	UTSW	4	130768847	missense	probably damaging	1.00
R6112:Pum1	UTSW	4	130730280	missense	probably damaging	1.00
R6416:Pum1	UTSW	4	130728287	splice site	probably null
R6426:Pum1	UTSW	4	130753972	missense	probably damaging	1.00
R6431:Pum1	UTSW	4	130774505	missense	probably damaging	1.00
R7226:Pum1	UTSW	4	130771981	missense	probably damaging	1.00
R7273:Pum1	UTSW	4	130751480	missense	probably damaging	0.99
R7423:Pum1	UTSW	4	130774545	missense	probably damaging	1.00
R7491:Pum1	UTSW	4	130719174	missense	probably benign	0.08
R7526:Pum1	UTSW	4	130747026	missense	probably damaging	0.99
R7731:Pum1	UTSW	4	130762963	missense	probably benign	0.29
R7911:Pum1	UTSW	4	130774477	missense	probably benign	0.40
R8065:Pum1	UTSW	4	130751525	missense	possibly damaging	0.90
R8067:Pum1	UTSW	4	130751525	missense	possibly damaging	0.90
R8305:Pum1	UTSW	4	130771920	missense	probably benign	0.02
R8476:Pum1	UTSW	4	130752713	missense	possibly damaging	0.91
R8835:Pum1	UTSW	4	130743753	missense	probably damaging	1.00
R8875:Pum1	UTSW	4	130779875	missense	possibly damaging	0.60
R9003:Pum1	UTSW	4	130747082	missense	probably benign	0.00
R9072:Pum1	UTSW	4	130752861	missense	probably damaging	1.00
R9073:Pum1	UTSW	4	130752861	missense	probably damaging	1.00
R9332:Pum1	UTSW	4	130771898	nonsense	probably null
R9496:Pum1	UTSW	4	130719353	critical splice donor site	probably null
R9801:Pum1	UTSW	4	130754017	missense	probably benign	0.28
X0024:Pum1	UTSW	4	130779790	missense	probably benign	0.00
Z1177:Pum1	UTSW	4	130751479	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGTCCTGTCCCAGTTAGC -3'
(R):5'- CCAGTTAGTTTACACCTCTATGGC -3'

Sequencing Primer
(F):5'- CCTGTCCCAGTTAGCATTTAGTGTAG -3'
(R):5'- CACCTCTATGGCATCATCTATACTAG -3'

Posted On

2014-10-01