Incidental Mutation 'R2164:Zbtb17'
ID 235340
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Name zinc finger and BTB domain containing 17
Synonyms mZ13, Zfp100, Miz1
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2164 (G1)
Quality Score 197
Status Not validated
Chromosome 4
Chromosomal Location 141444654-141467930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141464246 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold Q60821
Predicted Effect probably benign
Transcript: ENSMUST00000006377
AA Change: V223A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: V223A

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141466367 nonsense probably null
IGL01449:Zbtb17 APN 4 141463305 missense probably benign
IGL01835:Zbtb17 APN 4 141465438 critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141464953 missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141464982 missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141461829 missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141461913 missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141466885 missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141465088 missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141466933 missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141466758 missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141463380 missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141466096 splice site probably null
R0736:Zbtb17 UTSW 4 141461786 missense probably damaging 1.00
R1924:Zbtb17 UTSW 4 141464603 missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141465548 missense possibly damaging 0.83
R2517:Zbtb17 UTSW 4 141464585 missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141464988 missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141464575 missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141466498 missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141466549 missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141465631 missense probably benign 0.22
R5363:Zbtb17 UTSW 4 141466761 missense probably benign 0.02
R5987:Zbtb17 UTSW 4 141464817 missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6320:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6365:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141464950 missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141461799 missense probably damaging 1.00
R7717:Zbtb17 UTSW 4 141466083 missense probably damaging 1.00
R7999:Zbtb17 UTSW 4 141461823 missense probably damaging 1.00
R8542:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8544:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8545:Zbtb17 UTSW 4 141466828 unclassified probably benign
R8836:Zbtb17 UTSW 4 141461922 missense possibly damaging 0.68
R9072:Zbtb17 UTSW 4 141466365 missense possibly damaging 0.50
R9073:Zbtb17 UTSW 4 141466365 missense possibly damaging 0.50
R9389:Zbtb17 UTSW 4 141465820 missense possibly damaging 0.89
Z1176:Zbtb17 UTSW 4 141463679 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACAAGGACTTGGTTGGC -3'
(R):5'- TAAGCCTTGGACTCAGTGCG -3'

Sequencing Primer
(F):5'- ACTTGGTTGGCTGAAAATGC -3'
(R):5'- TTGGACTCAGTGCGATCCC -3'
Posted On 2014-10-01