Incidental Mutation 'R2164:Fam213b'
ID 235341
Institutional Source Beutler Lab
Gene Symbol Fam213b
Ensembl Gene ENSMUSG00000029059
Gene Name family with sequence similarity 213, member B
Synonyms PM/PGFS, 2810405K02Rik
MMRRC Submission 040167-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2164 (G1)
Quality Score 213
Status Not validated
Chromosome 4
Chromosomal Location 154895504-154899135 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 154898149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 56 (Y56S)
Ref Sequence ENSEMBL: ENSMUSP00000116611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030935] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000132281] [ENSMUST00000163732]
AlphaFold Q9DB60
Predicted Effect probably damaging
Transcript: ENSMUST00000030935
AA Change: Y100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030935
Gene: ENSMUSG00000029059
AA Change: Y100S

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 53 166 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079269
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105634
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105635
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129623
Predicted Effect probably damaging
Transcript: ENSMUST00000132281
AA Change: Y56S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116611
Gene: ENSMUSG00000029059
AA Change: Y56S

DomainStartEndE-ValueType
Pfam:AhpC-TSA_2 9 114 4.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163732
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Ankrd26 T G 6: 118,525,791 E806A probably damaging Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Fam213b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Fam213b APN 4 154896602 unclassified probably benign
IGL03102:Fam213b APN 4 154896601 unclassified probably benign
R1350:Fam213b UTSW 4 154898128 missense probably damaging 1.00
R1676:Fam213b UTSW 4 154897063 missense probably benign 0.05
R1778:Fam213b UTSW 4 154897357 missense probably damaging 0.98
R4468:Fam213b UTSW 4 154897050 missense probably benign 0.01
R5007:Fam213b UTSW 4 154897074 splice site probably null
R5386:Fam213b UTSW 4 154899005 start codon destroyed probably benign 0.01
R6820:Fam213b UTSW 4 154898166 missense probably damaging 1.00
R7437:Fam213b UTSW 4 154896596 missense possibly damaging 0.53
X0063:Fam213b UTSW 4 154898953 missense probably benign 0.03
Z1176:Fam213b UTSW 4 154898989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGCAGACTTCTGAGGACAGGC -3'
(R):5'- TGCCCTTCCCGTTTAAGCAG -3'

Sequencing Primer
(F):5'- TGCCTTGGACCAACACCCATTAG -3'
(R):5'- GCAGTGGTGACATTCAATCC -3'
Posted On 2014-10-01