Mutagenetix > Incidental Mutations

Incidental Mutation 'R2164:Snrnp27'

235343

Institutional Source

Beutler Lab

Gene Symbol

Snrnp27

Ensembl Gene

ENSMUSG00000001158

Gene Name

small nuclear ribonucleoprotein 27 (U4/U6.U5)

Synonyms

MMRRC Submission

040167-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86675151-86684522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 86676214 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 141 (C141S)

Ref Sequence

ENSEMBL: ENSMUSP00000109313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001186] [ENSMUST00000113683]

AlphaFold

Q8K194

Predicted Effect

probably benign
Transcript: ENSMUST00000001186

SMART Domains

Protein: ENSMUSP00000001186
Gene: ENSMUSG00000001158

Domain	Start	End	E-Value	Type
Pfam:DUF1777	1	151	1.8e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113683
AA Change: C141S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000109313
Gene: ENSMUSG00000001158
AA Change: C141S

Domain	Start	End	E-Value	Type
Pfam:DUF1777	1	139	1.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131674

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine-rich (SR) protein. SR proteins play important roles in pre-mRNA splicing by facilitating the recognition and selection of splice sites. The encoded protein associates with the 25S U4/U6.U5 tri-snRNP, a major component of the U2-type spiceosome. The expression of this gene may be altered in cells infected with the human T-cell lymphotropic virus type 1 (HTLV-1) retrovirus. A pseudogene of this gene is located on the long arm of chromosome 5. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Vmn2r25	A	T	6: 123,839,559	D354E	possibly damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Snrnp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02028:Snrnp27	APN	6	86682973	missense	unknown
IGL03198:Snrnp27	APN	6	86682986	splice site	probably null
PIT4131001:Snrnp27	UTSW	6	86682911	missense	unknown
R0136:Snrnp27	UTSW	6	86676205	missense	probably benign	0.07
R0242:Snrnp27	UTSW	6	86675593	unclassified	probably benign
R0375:Snrnp27	UTSW	6	86680953	missense	possibly damaging	0.83
R5245:Snrnp27	UTSW	6	86682959	missense	unknown
R6042:Snrnp27	UTSW	6	86682920	missense	unknown
R7667:Snrnp27	UTSW	6	86680953	missense	possibly damaging	0.83
R8812:Snrnp27	UTSW	6	86676214	missense	probably benign	0.03
R8946:Snrnp27	UTSW	6	86676244	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGGCAGAGCTAGTTGTTAC -3'
(R):5'- AAGTTCATGGGCTGTCCTC -3'

Sequencing Primer
(F):5'- GTTGTTACCATGTAAATTGGAAGGAC -3'
(R):5'- CATGGGCTGTCCTCTGGGG -3'

Posted On

2014-10-01