Incidental Mutation 'R2164:Ankrd26'
ID235344
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 040167-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2164 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 118525791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 806 (E806A)
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably damaging
Transcript: ENSMUST00000112830
AA Change: E806A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: E806A

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188172
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 CTGTAGGAAATCTTCAATGT CTGT 11: 110,210,193 probably null Het
Adcy8 C T 15: 64,920,934 G58S probably benign Het
Adgra2 T A 8: 27,114,204 L24* probably null Het
Ampd2 C A 3: 108,085,369 probably benign Het
Apol9b A G 15: 77,735,439 D145G probably benign Het
Ash1l T A 3: 88,985,419 M1535K probably benign Het
Atf6 A G 1: 170,794,735 M439T probably damaging Het
B3glct A T 5: 149,754,156 M417L probably damaging Het
Cep192 A T 18: 67,820,360 T483S probably damaging Het
Cep290 G A 10: 100,518,795 E914K probably damaging Het
Chst15 C T 7: 132,270,385 A56T probably damaging Het
Col27a1 A T 4: 63,225,424 T450S probably benign Het
Cpsf2 A G 12: 101,985,335 N177S probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Ctc1 C T 11: 69,035,615 A859V possibly damaging Het
Dcakd A G 11: 102,997,357 Y134H possibly damaging Het
Dctn3 G T 4: 41,723,065 Y22* probably null Het
Dync2h1 T A 9: 7,124,797 D2025V probably damaging Het
Dync2li1 T C 17: 84,636,274 S92P probably damaging Het
Eml5 A G 12: 98,887,097 V81A probably damaging Het
Espl1 C T 15: 102,319,588 R1625C probably damaging Het
Fam181a T C 12: 103,316,526 V230A probably benign Het
Fam213b T G 4: 154,898,149 Y56S probably damaging Het
Fanci T A 7: 79,395,995 D28E probably benign Het
Fmn1 A G 2: 113,365,617 N554S unknown Het
Frem2 T C 3: 53,537,330 Y2460C probably damaging Het
Fscb G A 12: 64,473,793 P300S probably damaging Het
Gm28042 A G 2: 120,036,748 D438G probably benign Het
Map1b C T 13: 99,429,338 V2292M unknown Het
Nbas A G 12: 13,330,646 D635G possibly damaging Het
Ncapg2 A G 12: 116,450,475 probably null Het
Nrp2 A T 1: 62,744,355 E205V probably damaging Het
Pcdhb3 A T 18: 37,302,186 T402S possibly damaging Het
Phc1 T C 6: 122,322,337 N638D possibly damaging Het
Plcb1 A G 2: 135,346,330 N781S possibly damaging Het
Prkdc T A 16: 15,705,207 D1164E probably damaging Het
Proser2 T A 2: 6,100,695 R353W possibly damaging Het
Ptges T A 2: 30,892,696 T115S probably benign Het
Ptprk A T 10: 28,560,142 D833V probably damaging Het
Pum1 T A 4: 130,728,083 L173* probably null Het
Pum1 G T 4: 130,728,084 L269F probably damaging Het
Rasgrp4 A G 7: 29,139,045 Y106C probably damaging Het
Rbbp6 T A 7: 122,999,474 probably benign Het
Rdh1 A G 10: 127,760,172 T79A possibly damaging Het
Relb A C 7: 19,613,761 probably null Het
Rnf122 G A 8: 31,112,164 W6* probably null Het
Rnf31 A G 14: 55,592,537 E138G possibly damaging Het
Scaf8 G A 17: 3,197,210 R936Q probably damaging Het
Scube3 T A 17: 28,166,134 V686D possibly damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Spns2 C T 11: 72,458,671 V252M possibly damaging Het
Tmem159 A G 7: 120,120,239 E157G possibly damaging Het
Tomm40l C T 1: 171,220,134 S220N probably damaging Het
Trim17 A G 11: 58,971,411 D423G probably damaging Het
Trpc6 A AT 9: 8,610,465 probably null Het
Uba5 A T 9: 104,060,243 M89K probably damaging Het
Vav2 T C 2: 27,273,706 D628G probably damaging Het
Vmn2r107 T C 17: 20,375,642 L819P probably damaging Het
Vmn2r25 A T 6: 123,839,559 D354E possibly damaging Het
Xrn1 A G 9: 96,006,820 E984G possibly damaging Het
Zbtb17 T C 4: 141,464,246 V223A probably benign Het
Zcchc11 G A 4: 108,503,029 R481Q possibly damaging Het
Zfp592 T C 7: 81,041,438 S1122P possibly damaging Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
murre UTSW 6 118549637 critical splice donor site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3107:Ankrd26 UTSW 6 118556243 missense probably benign 0.01
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527798 missense probably damaging 0.98
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
R7964:Ankrd26 UTSW 6 118523199 missense probably benign 0.03
R8078:Ankrd26 UTSW 6 118517893 splice site probably null
R8224:Ankrd26 UTSW 6 118525755 missense probably damaging 1.00
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACATATCTCAAGTGGCTCATGGAG -3'
(R):5'- CACAACGTGTTGAGGTCCAG -3'

Sequencing Primer
(F):5'- TCTCAAGTGGCTCATGGAGATATACG -3'
(R):5'- TGTTGAGGTCCAGGTCACAAC -3'
Posted On2014-10-01