Mutagenetix > Incidental Mutation

Incidental Mutation 'R2164:Vmn2r25'

235346

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r25

Ensembl Gene

ENSMUSG00000094672

Gene Name

vomeronasal 2, receptor 25

Synonyms

EG545874

MMRRC Submission

040167-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R2164 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123822814-123853190 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123839559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 354 (D354E)

Ref Sequence

ENSEMBL: ENSMUSP00000124342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000162046]

AlphaFold

W4VSP2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162046
AA Change: D354E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124342
Gene: ENSMUSG00000094672
AA Change: D354E

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	82	473	6e-31	PFAM
Pfam:NCD3G	519	572	5.8e-25	PFAM
Pfam:7tm_3	603	840	4.8e-55	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	CTGTAGGAAATCTTCAATGT	CTGT	11: 110,210,193		probably null	Het
Adcy8	C	T	15: 64,920,934	G58S	probably benign	Het
Adgra2	T	A	8: 27,114,204	L24*	probably null	Het
Ampd2	C	A	3: 108,085,369		probably benign	Het
Ankrd26	T	G	6: 118,525,791	E806A	probably damaging	Het
Apol9b	A	G	15: 77,735,439	D145G	probably benign	Het
Ash1l	T	A	3: 88,985,419	M1535K	probably benign	Het
Atf6	A	G	1: 170,794,735	M439T	probably damaging	Het
B3glct	A	T	5: 149,754,156	M417L	probably damaging	Het
Cep192	A	T	18: 67,820,360	T483S	probably damaging	Het
Cep290	G	A	10: 100,518,795	E914K	probably damaging	Het
Chst15	C	T	7: 132,270,385	A56T	probably damaging	Het
Col27a1	A	T	4: 63,225,424	T450S	probably benign	Het
Cpsf2	A	G	12: 101,985,335	N177S	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Ctc1	C	T	11: 69,035,615	A859V	possibly damaging	Het
Dcakd	A	G	11: 102,997,357	Y134H	possibly damaging	Het
Dctn3	G	T	4: 41,723,065	Y22*	probably null	Het
Dync2h1	T	A	9: 7,124,797	D2025V	probably damaging	Het
Dync2li1	T	C	17: 84,636,274	S92P	probably damaging	Het
Eml5	A	G	12: 98,887,097	V81A	probably damaging	Het
Espl1	C	T	15: 102,319,588	R1625C	probably damaging	Het
Fam181a	T	C	12: 103,316,526	V230A	probably benign	Het
Fam213b	T	G	4: 154,898,149	Y56S	probably damaging	Het
Fanci	T	A	7: 79,395,995	D28E	probably benign	Het
Fmn1	A	G	2: 113,365,617	N554S	unknown	Het
Frem2	T	C	3: 53,537,330	Y2460C	probably damaging	Het
Fscb	G	A	12: 64,473,793	P300S	probably damaging	Het
Gm28042	A	G	2: 120,036,748	D438G	probably benign	Het
Map1b	C	T	13: 99,429,338	V2292M	unknown	Het
Nbas	A	G	12: 13,330,646	D635G	possibly damaging	Het
Ncapg2	A	G	12: 116,450,475		probably null	Het
Nrp2	A	T	1: 62,744,355	E205V	probably damaging	Het
Pcdhb3	A	T	18: 37,302,186	T402S	possibly damaging	Het
Phc1	T	C	6: 122,322,337	N638D	possibly damaging	Het
Plcb1	A	G	2: 135,346,330	N781S	possibly damaging	Het
Prkdc	T	A	16: 15,705,207	D1164E	probably damaging	Het
Proser2	T	A	2: 6,100,695	R353W	possibly damaging	Het
Ptges	T	A	2: 30,892,696	T115S	probably benign	Het
Ptprk	A	T	10: 28,560,142	D833V	probably damaging	Het
Pum1	T	A	4: 130,728,083	L173*	probably null	Het
Pum1	G	T	4: 130,728,084	L269F	probably damaging	Het
Rasgrp4	A	G	7: 29,139,045	Y106C	probably damaging	Het
Rbbp6	T	A	7: 122,999,474		probably benign	Het
Rdh1	A	G	10: 127,760,172	T79A	possibly damaging	Het
Relb	A	C	7: 19,613,761		probably null	Het
Rnf122	G	A	8: 31,112,164	W6*	probably null	Het
Rnf31	A	G	14: 55,592,537	E138G	possibly damaging	Het
Scaf8	G	A	17: 3,197,210	R936Q	probably damaging	Het
Scube3	T	A	17: 28,166,134	V686D	possibly damaging	Het
Snrnp27	A	T	6: 86,676,214	C141S	probably benign	Het
Spns2	C	T	11: 72,458,671	V252M	possibly damaging	Het
Tmem159	A	G	7: 120,120,239	E157G	possibly damaging	Het
Tomm40l	C	T	1: 171,220,134	S220N	probably damaging	Het
Trim17	A	G	11: 58,971,411	D423G	probably damaging	Het
Trpc6	A	AT	9: 8,610,465		probably null	Het
Uba5	A	T	9: 104,060,243	M89K	probably damaging	Het
Vav2	T	C	2: 27,273,706	D628G	probably damaging	Het
Vmn2r107	T	C	17: 20,375,642	L819P	probably damaging	Het
Xrn1	A	G	9: 96,006,820	E984G	possibly damaging	Het
Zbtb17	T	C	4: 141,464,246	V223A	probably benign	Het
Zcchc11	G	A	4: 108,503,029	R481Q	possibly damaging	Het
Zfp592	T	C	7: 81,041,438	S1122P	possibly damaging	Het

Other mutations in Vmn2r25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Vmn2r25	APN	6	123853171	missense	probably benign	0.25
IGL01781:Vmn2r25	APN	6	123839365	missense	possibly damaging	0.48
IGL01843:Vmn2r25	APN	6	123853003	missense	possibly damaging	0.67
IGL02023:Vmn2r25	APN	6	123839429	missense	probably damaging	0.96
IGL02502:Vmn2r25	APN	6	123839433	missense	probably damaging	0.96
IGL02709:Vmn2r25	APN	6	123839764	missense	possibly damaging	0.50
IGL03053:Vmn2r25	APN	6	123823118	missense	probably damaging	1.00
PIT4468001:Vmn2r25	UTSW	6	123839598	missense	probably benign	0.00
PIT4812001:Vmn2r25	UTSW	6	123823488	missense	probably damaging	1.00
R0054:Vmn2r25	UTSW	6	123853025	missense	probably benign	0.00
R0312:Vmn2r25	UTSW	6	123828580	splice site	probably benign
R0366:Vmn2r25	UTSW	6	123823622	nonsense	probably null
R0390:Vmn2r25	UTSW	6	123823181	missense	probably damaging	1.00
R0466:Vmn2r25	UTSW	6	123852049	missense	probably benign	0.16
R0541:Vmn2r25	UTSW	6	123839827	missense	probably damaging	0.97
R0612:Vmn2r25	UTSW	6	123839522	missense	probably damaging	1.00
R0865:Vmn2r25	UTSW	6	123853017	missense	probably benign	0.09
R1219:Vmn2r25	UTSW	6	123839323	missense	probably benign	0.00
R1240:Vmn2r25	UTSW	6	123851905	missense	probably damaging	0.98
R1701:Vmn2r25	UTSW	6	123851795	splice site	probably null
R1780:Vmn2r25	UTSW	6	123828465	missense	probably damaging	1.00
R1809:Vmn2r25	UTSW	6	123825378	missense	probably benign	0.00
R1833:Vmn2r25	UTSW	6	123839684	missense	probably benign	0.01
R1964:Vmn2r25	UTSW	6	123823295	missense	possibly damaging	0.94
R2154:Vmn2r25	UTSW	6	123839846	missense	probably benign	0.01
R3799:Vmn2r25	UTSW	6	123853184	missense	probably benign	0.12
R3836:Vmn2r25	UTSW	6	123853085	missense	probably damaging	1.00
R3946:Vmn2r25	UTSW	6	123840098	missense	probably damaging	0.97
R4282:Vmn2r25	UTSW	6	123823647	missense	probably damaging	1.00
R4367:Vmn2r25	UTSW	6	123828537	missense	probably damaging	1.00
R4438:Vmn2r25	UTSW	6	123839797	missense	probably benign	0.03
R4488:Vmn2r25	UTSW	6	123822860	missense	probably damaging	1.00
R4580:Vmn2r25	UTSW	6	123823023	missense	possibly damaging	0.46
R4631:Vmn2r25	UTSW	6	123853003	missense	possibly damaging	0.94
R4765:Vmn2r25	UTSW	6	123823223	missense	probably damaging	1.00
R4908:Vmn2r25	UTSW	6	123828447	missense	probably benign
R5207:Vmn2r25	UTSW	6	123840103	missense	probably damaging	1.00
R5254:Vmn2r25	UTSW	6	123825318	missense	probably damaging	1.00
R5444:Vmn2r25	UTSW	6	123828492	missense	probably benign	0.00
R5586:Vmn2r25	UTSW	6	123825296	missense	probably damaging	1.00
R5607:Vmn2r25	UTSW	6	123828359	missense	possibly damaging	0.49
R5985:Vmn2r25	UTSW	6	123823628	missense	probably benign
R6046:Vmn2r25	UTSW	6	123822917	missense	probably damaging	1.00
R6057:Vmn2r25	UTSW	6	123822941	missense	possibly damaging	0.69
R6569:Vmn2r25	UTSW	6	123851982	missense	probably benign	0.01
R6826:Vmn2r25	UTSW	6	123823112	missense	probably damaging	1.00
R7054:Vmn2r25	UTSW	6	123823610	missense	probably damaging	1.00
R7120:Vmn2r25	UTSW	6	123828435	missense	possibly damaging	0.51
R7177:Vmn2r25	UTSW	6	123839923	missense	possibly damaging	0.94
R7287:Vmn2r25	UTSW	6	123852081	missense	possibly damaging	0.49
R7397:Vmn2r25	UTSW	6	123823539	missense	probably damaging	0.96
R7486:Vmn2r25	UTSW	6	123823142	missense	probably damaging	1.00
R7699:Vmn2r25	UTSW	6	123839923	missense	possibly damaging	0.94
R7700:Vmn2r25	UTSW	6	123839923	missense	possibly damaging	0.94
R7759:Vmn2r25	UTSW	6	123823380	missense	probably damaging	0.99
R7802:Vmn2r25	UTSW	6	123851832	missense	possibly damaging	0.88
R7850:Vmn2r25	UTSW	6	123828472	missense	probably damaging	1.00
R8064:Vmn2r25	UTSW	6	123823622	nonsense	probably null
R8170:Vmn2r25	UTSW	6	123853017	missense	probably benign	0.09
R8340:Vmn2r25	UTSW	6	123853013	missense	probably benign	0.01
R8346:Vmn2r25	UTSW	6	123825391	missense	probably benign	0.00
R8395:Vmn2r25	UTSW	6	123823023	missense	possibly damaging	0.81
R8889:Vmn2r25	UTSW	6	123823610	missense	probably damaging	1.00
R9094:Vmn2r25	UTSW	6	123828432	missense	probably benign	0.44
R9204:Vmn2r25	UTSW	6	123853133	missense	probably benign	0.00
R9253:Vmn2r25	UTSW	6	123840001	missense	probably damaging	0.98
R9392:Vmn2r25	UTSW	6	123839978	missense	probably benign
R9520:Vmn2r25	UTSW	6	123853107	nonsense	probably null
R9525:Vmn2r25	UTSW	6	123823205	missense	probably damaging	1.00
R9622:Vmn2r25	UTSW	6	123839620	missense	probably damaging	0.99
X0020:Vmn2r25	UTSW	6	123839400	missense	possibly damaging	0.95
Z1176:Vmn2r25	UTSW	6	123822897	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACACAGCAGCATGGACTTTG -3'
(R):5'- TGGAGACACACATTCTCTTCTG -3'

Sequencing Primer
(F):5'- CAGCAGCATGGACTTTGTAGCTC -3'
(R):5'- AGACACACATTCTCTTCTGCGAATTG -3'

Posted On

2014-10-01